Tag Archives: chromatin

Monday 02/03/2014

Posted on February 3, 2014 by admin

10:00a – 11:50a Seminars Hao practice talk for lab meeting, 11a – 1p. Tamara’s seminar at the stat depart colloquium, (see notes) Ph Project manuscript work working on re-arranging figure panels and colors added whole cell images to figure 2 … Continue reading →

Posted in Summaries | Tagged , , , , , | Comments Off on Monday 02/03/2014

Sunday 02/02/14

Posted on February 2, 2014 by admin

10:00a – 7:30p, 9:50p – 1:40a Literature need an article for journal club in 2 weeks. Elife article on transcription imaging from Tijan lab. Feng Zhang lab optical control of transcription. Optical control of transcription. Nature, this was published 7 … Continue reading →

Posted in Summaries | Tagged , , | Comments Off on Sunday 02/02/14

Friday 01/31/14

Posted on January 31, 2014 by admin

10:50a – 11:50p Goals Today Order primers for sequencing work on Ph manuscript finish hybes to test sample age image F03F04 samples Deep sequencing 2 probes to order with sequencing indices D12 (375kb) GTGTCGCGTCGGCCAGAAAC F11 (180kb) AGGACATTCGCGGCTTTCAG G09 (76kb) CGTCGCGTTGGATTCAAGAG … Continue reading →

Posted in Summaries | Tagged , , , | Comments Off on Friday 01/31/14

Thursday 01/30/14

Posted on January 30, 2014 by admin

9:55a – 10:00p Chromatin Project cell fixing and staining fix new Kc cells prep for in situ treat with RNase stain new kc cells with F03F04 and G01G02 Ph Data analysis wt data has half the number of frames (54,000 … Continue reading →

Posted in Summaries | Tagged , | Comments Off on Thursday 01/30/14

Wednesday 01/29/14

Posted on January 29, 2014 by admin

9:10a – 8:00p, 9:50p – 2:30a Ph project revising manuscript draft working on abstract refocusing discussion of PcG clusters. Need to distinguish between the sparse micron-scale PcG bodies other people have studied and the numerous, nano-scale bodies we focus on. … Continue reading →

Posted in Summaries | Tagged , , | Comments Off on Wednesday 01/29/14

Tuesday 01/28/14

Posted on January 28, 2014 by admin

9:15a – 10:50a, 12:00p – 10:15p Chromatin Project Chromatin Analysis Data Analysis Continued analyzing D12 data from 10-26-13 up through image 26 (still plenty more dots to image). F06 analyzed up to but not including image 0_2. Developing analysis pipeline … Continue reading →

Posted in Summaries | Tagged , | Comments Off on Tuesday 01/28/14

Protected: chromatin analysis in progress

Posted on January 28, 2014 by admin

There is no excerpt because this is a protected post.

Posted in Chromatin | Tagged , | Comments Off on Protected: chromatin analysis in progress

Sunday 01/26/14

Posted on January 26, 2014 by admin

10:20a – 10:00p Literature reading Polycomb Potentiates Meis2 Activation in Midbrain by Mediating Interaction of the Promoter with a Tissue-Specific Enhancer read Cavalli’s summary Ring1 activator and repressor. Article makes it sound to me like Ring1 is an activator. Just … Continue reading →

Posted in Summaries | Tagged , , | Comments Off on Sunday 01/26/14

Chromatin Project, short-term goals

Posted on January 22, 2014 by admin

Issues with current data analysis In trying to get of order 100 loci per chromatin domain I’ve take a bunch of partially imaged edge of focus domains or other less well defined images (e.g. near edge of field of view). … Continue reading →

Posted in Chromatin | Tagged , | Comments Off on Chromatin Project, short-term goals

Protected: Library2 Data Summaries

Posted on January 22, 2014 by admin

There is no excerpt because this is a protected post.

Posted in Chromatin | Tagged , , | Comments Off on Protected: Library2 Data Summaries