Tag Archives: Ph

Monday 02/03/2014

10:00a – 11:50a Seminars Hao practice talk for lab meeting, 11a – 1p. Tamara’s seminar at the stat depart colloquium, (see notes) Ph Project manuscript work working on re-arranging figure panels and colors added whole cell images to figure 2 … Continue reading

Posted in Summaries | Tagged , , , , , | Comments Off on Monday 02/03/2014

Sunday 02/02/14

10:00a – 7:30p, 9:50p – 1:40a Literature need an article for journal club in 2 weeks. Elife article on transcription imaging from Tijan lab. Feng Zhang lab optical control of transcription. Optical control of transcription. Nature, this was published 7 … Continue reading

Posted in Summaries | Tagged , , | Comments Off on Sunday 02/02/14

Friday 01/31/14

10:50a – 11:50p Goals Today Order primers for sequencing work on Ph manuscript finish hybes to test sample age image F03F04 samples Deep sequencing 2 probes to order with sequencing indices D12 (375kb) GTGTCGCGTCGGCCAGAAAC F11 (180kb) AGGACATTCGCGGCTTTCAG G09 (76kb) CGTCGCGTTGGATTCAAGAG … Continue reading

Posted in Summaries | Tagged , , , | Comments Off on Friday 01/31/14

Thursday 01/30/14

9:55a – 10:00p Chromatin Project cell fixing and staining fix new Kc cells prep for in situ treat with RNase stain new kc cells with F03F04 and G01G02 Ph Data analysis wt data has half the number of frames (54,000 … Continue reading

Posted in Summaries | Tagged , | Comments Off on Thursday 01/30/14

Wednesday 01/29/14

9:10a – 8:00p, 9:50p – 2:30a Ph project revising manuscript draft working on abstract refocusing discussion of PcG clusters. Need to distinguish between the sparse micron-scale PcG bodies other people have studied and the numerous, nano-scale bodies we focus on. … Continue reading

Posted in Summaries | Tagged , , | Comments Off on Wednesday 01/29/14

Saturday 01/18/2014

10:30a – 7:20p, matlab-storm STORMrender online Getting Jeff set up with STORMrender debugging: STORMfinder added paths in initialization, allowing matlab-storm to access depreciated versions of code in folders that weren’t supposed to be on filepath Features to add to STORMrender … Continue reading

Posted in Summaries | Tagged , , , | Comments Off on Saturday 01/18/2014

Tuesday 01/14/14

9:45a – 12:15a Goals Today Rewrite ColorIntervalJumpGap.m Function to allow different gaps for different chromatin types. Select new Red regions Chromatin Project analysis Designing some new regions: notes Writing up summary of chromatin regions thus far: see protected notes. Let’s … Continue reading

Posted in Summaries | Tagged , , | Comments Off on Tuesday 01/14/14

Thursday 01/09/14

9:50a – 5:30p, 10:00p – 12:15a Goals file reimbursement paperwork for post-doc visit check to Colenso for ski trip help Sebastian design probes chromatin project Run probe design for new chromatin regions selected to test off-diagonal HiC contacts Too many … Continue reading

Posted in Summaries | Tagged , | Comments Off on Thursday 01/09/14

Protected: Ph project, cell variation issues

There is no excerpt because this is a protected post.

Posted in Chromatin | Tagged | Comments Off on Protected: Ph project, cell variation issues

Wednesday 01/08/14

10:00a – 5:30p, 9:30p – 11:30p Ph project Ph project model figures for Ajaz. See post Reorganized figure producing code (see Code\Results) Chromatin analysis copying F05 data over to Probox 7 Running analysis of F03 and F04 while copying data … Continue reading

Posted in Summaries | Tagged , , | Comments Off on Wednesday 01/08/14