September 2025 M T W T F S S « Aug 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 Categories
- AP patterning (13)
- Blog (1)
- Chromatin (88)
- Conference Notes (72)
- Fly Work (54)
- General STORM (25)
- Genomics (134)
- Journal Club (22)
- Lab Meeting (66)
- Microscopy (79)
- Notes (1)
- probe and plasmid building (58)
- Project Meeting (3)
- Protocols (13)
- Research Planning (74)
- Seminars (21)
- Shadow Enhancers (59)
- snail patterning (40)
- Software Development (5)
- Summaries (1,412)
- Teaching (9)
- Transcription Modeling (40)
- Uncategorized (10)
- Web development (19)
Links
Tags
analysis cell culture cell labeling chromatin cloning coding communication confocal data analysis embryo collection embryo labeling figures fly work genomics hb image analysis image processing images in situs Library2 literature making antibodies matlab-storm meetings modeling MP12 mRNA counting Ph planning presentation probe making project 2 project2 result results sectioning section staining shadow enhancers sna snail staining STORM STORM analysis troubleshooting writing-
GitHub Projects
Tag Archives: chromatin
Monday 02/03/2014
10:00a – 11:50a Seminars Hao practice talk for lab meeting, 11a – 1p. Tamara’s seminar at the stat depart colloquium, (see notes) Ph Project manuscript work working on re-arranging figure panels and colors added whole cell images to figure 2 … Continue reading
Sunday 02/02/14
10:00a – 7:30p, 9:50p – 1:40a Literature need an article for journal club in 2 weeks. Elife article on transcription imaging from Tijan lab. Feng Zhang lab optical control of transcription. Optical control of transcription. Nature, this was published 7 … Continue reading
Friday 01/31/14
10:50a – 11:50p Goals Today Order primers for sequencing work on Ph manuscript finish hybes to test sample age image F03F04 samples Deep sequencing 2 probes to order with sequencing indices D12 (375kb) GTGTCGCGTCGGCCAGAAAC F11 (180kb) AGGACATTCGCGGCTTTCAG G09 (76kb) CGTCGCGTTGGATTCAAGAG … Continue reading
Thursday 01/30/14
9:55a – 10:00p Chromatin Project cell fixing and staining fix new Kc cells prep for in situ treat with RNase stain new kc cells with F03F04 and G01G02 Ph Data analysis wt data has half the number of frames (54,000 … Continue reading
Wednesday 01/29/14
9:10a – 8:00p, 9:50p – 2:30a Ph project revising manuscript draft working on abstract refocusing discussion of PcG clusters. Need to distinguish between the sparse micron-scale PcG bodies other people have studied and the numerous, nano-scale bodies we focus on. … Continue reading
Tuesday 01/28/14
9:15a – 10:50a, 12:00p – 10:15p Chromatin Project Chromatin Analysis Data Analysis Continued analyzing D12 data from 10-26-13 up through image 26 (still plenty more dots to image). F06 analyzed up to but not including image 0_2. Developing analysis pipeline … Continue reading
Protected: chromatin analysis in progress
There is no excerpt because this is a protected post.
Sunday 01/26/14
10:20a – 10:00p Literature reading Polycomb Potentiates Meis2 Activation in Midbrain by Mediating Interaction of the Promoter with a Tissue-Specific Enhancer read Cavalli’s summary Ring1 activator and repressor. Article makes it sound to me like Ring1 is an activator. Just … Continue reading
Chromatin Project, short-term goals
Issues with current data analysis In trying to get of order 100 loci per chromatin domain I’ve take a bunch of partially imaged edge of focus domains or other less well defined images (e.g. near edge of field of view). … Continue reading
Protected: Library2 Data Summaries
There is no excerpt because this is a protected post.