April 2024 M T W T F S S « Aug 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 Categories
- AP patterning (13)
- Blog (1)
- Chromatin (88)
- Conference Notes (72)
- Fly Work (54)
- General STORM (25)
- Genomics (134)
- Journal Club (22)
- Lab Meeting (66)
- Microscopy (79)
- Notes (1)
- probe and plasmid building (58)
- Project Meeting (3)
- Protocols (13)
- Research Planning (74)
- Seminars (21)
- Shadow Enhancers (59)
- snail patterning (40)
- Software Development (5)
- Summaries (1,412)
- Teaching (9)
- Transcription Modeling (40)
- Uncategorized (10)
- Web development (19)
Links
Tags
analysis cell culture cell labeling chromatin cloning coding communication confocal data analysis embryo collection embryo labeling figures fly work genomics hb image analysis image processing images in situs Library2 literature making antibodies matlab-storm meetings modeling MP12 mRNA counting Ph planning presentation probe making project 2 project2 result results sectioning section staining shadow enhancers sna snail staining STORM STORM analysis troubleshooting writing-
GitHub Projects
Tag Archives: figures
Monday 02/03/2014
10:00a – 11:50a Seminars Hao practice talk for lab meeting, 11a – 1p. Tamara’s seminar at the stat depart colloquium, (see notes) Ph Project manuscript work working on re-arranging figure panels and colors added whole cell images to figure 2 … Continue reading
Friday 01/31/14
10:50a – 11:50p Goals Today Order primers for sequencing work on Ph manuscript finish hybes to test sample age image F03F04 samples Deep sequencing 2 probes to order with sequencing indices D12 (375kb) GTGTCGCGTCGGCCAGAAAC F11 (180kb) AGGACATTCGCGGCTTTCAG G09 (76kb) CGTCGCGTTGGATTCAAGAG … Continue reading
Wednesday 12/11/13
11:15a – 11:45p Ph Project Highly variable radius of gyration measurements for case with binding — suggests not equilbirated. Binding strength probably much to high. Up to .90, run again. Also increased density of K27me3 sites from 50% to 80%, … Continue reading
Posted in Summaries
Tagged cell labeling, communication, figures, images, STORM2
Comments Off on Wednesday 12/11/13
Thursday 01/10/13
8:30A – 10:30P Flip collection plate 8:30A Fixing embryos 10:30A. (20 min 8% FA reaction) O/N confocal runs — 700 at speed 4 still running. 5 not quite as clean. copy data. Make new fly plates (~4 tubes of plates). … Continue reading
Thursday 09/27/12
9:35 A – 10:10 P Revising text Revising figures: convert all fonts, etc Finished first complete run-through of response to reviewers, Additional to do. (X indicates complete) X reformat all references (opening on laptop lost references?) X check that legends … Continue reading
Wednesday 08/26/12
9:45 A – 7:30P, 9:30P – 12:15 A Coding (To do) Convert all function calls in STORMrenderer that are not button press objects to separate, free-living functions. (Maybe make subfolder ‘routines’ and save in there?) This way these functions can … Continue reading
Protected: Tuesday 09/12/12
There is no excerpt because this is a protected post.
Sunday 09/09/12
4:00P-7:00P, 9:45P-11:30P Organizing snail data in lab notebook summary (see post). Figured out how to add multiple different slideshows to same post (can reference a wordpress object/post by id=xxxx. can also use include = attachment id. (mouse over thumbnail for … Continue reading
Tuesday 09/04/12
9:30A -4:00P Take bead images for color calibration. (looks like system may have relaxed and is now clipping on the right instead of on the left? Check when next I have scope time… Temporal analysis of snail dynamics with different … Continue reading
Protected: snail figure updates
There is no excerpt because this is a protected post.