Tag Archives: figures

Monday 02/03/2014

10:00a – 11:50a Seminars Hao practice talk for lab meeting, 11a – 1p. Tamara’s seminar at the stat depart colloquium, (see notes) Ph Project manuscript work working on re-arranging figure panels and colors added whole cell images to figure 2 … Continue reading

Posted in Summaries | Tagged , , , , , | Comments Off on Monday 02/03/2014

Friday 01/31/14

10:50a – 11:50p Goals Today Order primers for sequencing work on Ph manuscript finish hybes to test sample age image F03F04 samples Deep sequencing 2 probes to order with sequencing indices D12 (375kb) GTGTCGCGTCGGCCAGAAAC F11 (180kb) AGGACATTCGCGGCTTTCAG G09 (76kb) CGTCGCGTTGGATTCAAGAG … Continue reading

Posted in Summaries | Tagged , , , | Comments Off on Friday 01/31/14

Wednesday 12/11/13

11:15a – 11:45p Ph Project Highly variable radius of gyration measurements for case with binding — suggests not equilbirated. Binding strength probably much to high. Up to .90, run again. Also increased density of K27me3 sites from 50% to 80%, … Continue reading

Posted in Summaries | Tagged , , , , | Comments Off on Wednesday 12/11/13

Thursday 01/10/13

8:30A – 10:30P Flip collection plate 8:30A Fixing embryos 10:30A.  (20 min 8% FA reaction) O/N confocal runs — 700 at speed 4 still running.  5 not quite as clean. copy data. Make new fly plates (~4 tubes of plates). … Continue reading

Posted in Summaries | Tagged , , | Comments Off on Thursday 01/10/13

Thursday 09/27/12

9:35 A  – 10:10 P Revising text Revising figures: convert all fonts, etc Finished first complete run-through of response to reviewers,  Additional to do.  (X indicates complete) X reformat all references (opening on laptop lost references?) X check that legends … Continue reading

Posted in Summaries | Tagged , | Comments Off on Thursday 09/27/12

Wednesday 08/26/12

9:45 A – 7:30P, 9:30P – 12:15 A Coding (To do) Convert all function calls in STORMrenderer that are not button press objects to separate, free-living functions.  (Maybe make subfolder ‘routines’ and save in there?) This way these functions can … Continue reading

Posted in Summaries | Tagged , | Comments Off on Wednesday 08/26/12

Protected: Tuesday 09/12/12

There is no excerpt because this is a protected post.

Posted in Summaries | Tagged , , | Comments Off on Protected: Tuesday 09/12/12

Sunday 09/09/12

4:00P-7:00P, 9:45P-11:30P Organizing snail data in lab notebook summary (see post).  Figured out how to add multiple different slideshows to same post (can reference a wordpress object/post by id=xxxx.  can also use include = attachment id. (mouse over thumbnail for … Continue reading

Posted in Summaries | Tagged | Comments Off on Sunday 09/09/12

Tuesday 09/04/12

9:30A -4:00P Take bead images for color calibration.  (looks like system may have relaxed and is now clipping on the right instead of on the left?  Check when next I have scope time… Temporal analysis of snail dynamics with different … Continue reading

Posted in Summaries | Tagged , , | Comments Off on Tuesday 09/04/12

Protected: snail figure updates

There is no excerpt because this is a protected post.

Posted in snail patterning | Tagged , | Comments Off on Protected: snail figure updates