About my notebook

This is my lab notebook.  It is how I organize and document my scientific research on a day-to-day basis.  It is intended primarily for my personal use as a permenant record of my work.

Unlike traditional notebooks, it is text searchable.  All notes are listed in appropriate categories, and I can easily rearrange my notebook to display only posts relating to a particular category.  Research images, from gel photos to simulation results to draft figures for manuscripts are included as images, and automatically become part of a date-tagged browsable image collection.  Hyperlinks let me connect protocols and references.

My notebook also automatically tracks my code development, through RSS feed forwarded by my code repository in Github.  The notebook additionally keeps track of what I’m reading, through RSS feed run through Mendeley (when the API works).

In addition to being more convenient, I hope this notebook contributes in a small way to making Science more Open.  Much of what we do as academic researchers is never published, and these findings (though funded generally by tax payer dollars) are forever lost to the world.  Much of what is published is only available in expensive, specialized journals which most of the world does not have access to.  It is my hope, and that of the Open Science Movement, that the technologies of Web2.0 enable us to move to a world where this is no longer the case.  In an open or partially open web hosted notebook, all the unpublished ideas and discoveries can still be easily released to the world, where they are text-searchable and easily discoverable, so that other researchers can benefit from them.

Unpublished information that I am not yet ready to share with the world at large is protected by passwords.  These can be shared with individual collaborators of mine, and removed once the relevant work is published.

I have received much inspiration, encouragement, and technical support from several individuals.  Most importantly, my brother Carl Boettiger, who is a leading figure in the Open Science Movement at Davis, and keeps a Open Notebook here.

Posted on by admin | Leave a comment

Protected: post-doc interview 04-08-16

This content is password protected. To view it please enter your password below:

Posted in Lab Meeting | Comments Off on Protected: post-doc interview 04-08-16

Protected: Jun-Han lab meeting

This content is password protected. To view it please enter your password below:

Posted in Journal Club | Comments Off on Protected: Jun-Han lab meeting

Protected: lab meeting 03/25/15

This content is password protected. To view it please enter your password below:

Posted in Lab Meeting, Summaries | Comments Off on Protected: lab meeting 03/25/15

Thursday, 03/24/16

9:00 am – 8:40 pm

Fluid control

challenges

  • fluid control system from STORM1
  • need drivers for the usb-to-serial connection to the peristaltic pump
  • switching to a new usb-to-serial hub didn’t work (windows recognizes, kilroy fails communication)
  • eventually found, downloaded and installed correct drivers. Kilroy works now.
  • updated shortcuts on desktop – Andor is now hal-storm2 (not hal.bat).

observations from bit 1

  • (staining L8, using 20mers)
  • old settings file don’t display well with new Hal configurations (though they do run).
  • first toe-hold removal looks great.
  • ran flow system. bit 2 looks better than bit 1 did.
  • set up O/N run with flow system for bits 1-8.
  • attempting to do 50 step z-scans using quadview image at all positions.
Posted in Summaries | Comments Off on Thursday, 03/24/16

Wednesday 03/23/16

9:00 am – 7:30 pm, 8:45 pm – 12:00 am

Sectioning observations

  • mounting sample in the sharp-nosed conic capsules is actually excellent for ultra-cryo mount (should order more of these)

Testing L8

  • 12:00 pm, incubating L7 and L8 on recently sectioned embryos.
  • 5:00 pm, mounting sample into Bioptics chamber.
    • apparently mounted incorrectly, no embryo sections visible in chamber
  • 8:00 pm,
    • confirmed some sections are still bound, though I notice even in this ribbon several embryos detaching
    • other ribbons depostied on this coverslip detached completely. Maybe go back to trying gelatin/chromium again?
  • 9:30 pm, remounted sample now correctly localizes embryos
    • notes: cy3 channel autofluorescence not very bright. Should WGA-488 label embryos and use 488 channel for contrast
    • accidently partially bleached cy3 dyes while searching for sample
    • notable issues with sample depth and focus. Trust the focus lock, but remember there are sometimes two places where it starts to report signal. Also trust the 4x image.
  • 10:38 pm, added bit 1 in R-buffer (with dextran sulfate)
    • observation: adapter tubing didn’t transmit pressure with dextran sulfate in solution. had to add solution directly to chamber.
    • My have introduced translation into stage, will need to check.
  • incubating 30 minutes
    • thin stiff tubing is very trick to pipette through and readily creates air bubbles
    • thicker tubing pipettes much better. easy to remove air bubbles.
  • cy3 spots look good
  • Alexa647 spots detectable, but I expected better for 15kb.

STORM6 prep

  • mapping out design for focus lock
  • copied STORM2 layout, matched to parts list on STORM5.
  • started new illustrator file
    FocusLock8

checking sequences

Checking sequences in L8. These are the readout probe binding sequences in L8, and the 20mer root of the corresponding probes.
These appear to be Stv8 through Stv1.

cellfun(@seqrcomplement,choseSeqs,'UniformOutput',false)
ans =
'GCGCGATTGACCGTCTCGTT'
'GCCACGGTCCCGTTGAACTT'
'CCGATGCGCAGCAATTCACT'
'CCAGATCGGACGATCATGGG'
'GGGACGGTTCCAATCGGATC'
'CCGTAACGAGCGTCCCTTGC'
'GGCCTCGAACGAACGATAGC'
'CGTCCAGCGCGTCAAACAGA'

choseSeqs = unique(stvSecs,'stable')';
cellfun(@seqrcomplement,choseSeqs,'UniformOutput',false)
ans =
'CCGTAACGAGCGTCCCTTGC'
'CGTCCAGCGCGTCAAACAGA'
'GCCACGGTCCCGTTGAACTT'
'CCGATGCGCAGCAATTCACT'
'GCGCGATTGACCGTCTCGTT'
'CCAGATCGGACGATCATGGG'
'GGCCTCGAACGAACGATAGC'
'GGGACGGTTCCAATCGGATC'
<\code>

upgrading matlab to 2016a.

Posted in Summaries | Comments Off on Wednesday 03/23/16

Tuesday 03/22/16

9:00 am – 5:00 pm

Ultra-sectioning

  • Fill LN2 (upstairs dewar is empty need to go downstairs to fill)
  • Poly-lysine coat newly cleaned 50 mm coverslips — dipped in pure poly-D lysine solution
    • substantial residue after air drying. The adhered samples seem to resist washing
    • dip into ddH2O to dissolve excess salts. Hopefully the samples still stick.
  • 10:20 am – started cool down of LN2
  • cryo-knife has dissappeared.
    • knife was exchanged for a wet knife
    • ordered a new histo cryo (cost here) details here, see p 20.
  • cutting 1.5 um sections with Diamond cryotrim knife
  • settings: -51C knife, -50C sample, -50C chamber.
    • most of the morning cutting was very smooth, readily get 10 sections
  • other parts in need of replacing
    • both perfect loops are damaged
    • all the eyelash brushes are decapitated. Made 2 new ones.

sample prep for DNA staining

  • ran staining protocol for two large coverslips
  • samples now in 50% formamide 2x SSC in 4C, ready for staining
  • actually could have had samples ready for tomorrow, too bad I already gave away my scope time.
  • should label with libraries L8-cy3 and L7-cy3 tomorrow.
Posted in Summaries | Comments Off on Tuesday 03/22/16

Monday 03/21/16

10:00 am – 6:30 pm

Tasks

  • see private post from today for to dos.

Experiments

  • rehydrated embryos
  • embedded in 12% gelatin
  • incubating step-wise into 70% sucrose for freezing
  • scheduled cryo-ultratome for tomorrow.

Microscope setup

  • spec’ing and ordering parts — see STORM6 list in Drive
  • private web address
Posted in Summaries | Comments Off on Monday 03/21/16

Protected: Caltech Symposium 03/18/16

This content is password protected. To view it please enter your password below:

Posted in Conference Notes | Comments Off on Protected: Caltech Symposium 03/18/16

Tuesday 03/09/16

9:45 am – 7:15 pm

Probe synthesis

Set up RT reactions

  • ran RT reactions
  • ran gel
  • ran oligo cleanup
  • see updated protocol
  • Gel results: (Lib7-10 kb BX-C, Lib7-2kb BX-C, Lib8-15 kb en), DNA left, Cy3 right (with gel green blead-through).
    Lib7and8probes_PAGE_gel

Project planning

  • prepare slides for meeting with XZ discuss next chromatin project
  • discuss project design with BB
  • meeting with XZ

Orders & Paperwork

  • place T7 order with NEB
  • sent request to Alec for PolyD Lysine order
  • send paperwork to UCSF
Posted in Summaries | Comments Off on Tuesday 03/09/16

Monday, 03/08/16

10:00 am – 6:00 pm,

New Library synthesis

  • chr-L8 (en-locus)
    • T7 L6E3_R primer_232 TAATACGACTCACTATAGGG TTGCGCGAGACCAACGTACG
    • L6E1_F primer_226 CCGTACGTCGAGTCGGGTCG
    • Was: T7 L6E2_R primer_230 TAATACGACTCACTATAGGG TGATCATCGCTCGCGGGTTG, swapped out for L6E3_R to avoid cross-talk with DSB-lib
  • Also doing L7 10 kb and 2 kb (to make in cy3).

per reaction

  • 25 uL enzyme-master
  • 2.5 uL 1:40 library
  • 2.5 uL F
  • 2.5 uL R
  • 2.5 uL EvaGreen
  • 10 uL ddH2O

Master

  • 100 enzyme + 10 Evagreen + 40 ddH2O, 40 ea.
  • sample order: tab, L8 (en), L7-10kb (BXC), L7-2kb (BXC)
  • out of 10x Sodium Borax (Na-Borax). 10g Sodium Tetraborate in 1 L ddH2O

Column cleanup

  • per instructions, on DCC-5
  • ran gel. Order: L8a, L7 10 kb, L7 2 kb, L8 try 2
    lib7and8_template_labeled_160308

Observations: L8 failed both times (amplified up through cycle 30 first time, didn’t start until cycle 25, started around cycle 22 when run at 62C annealing instead of 65C for second run, still stopped at cycle 30). L8 probes amplified by cycle 25 (later than last time). Bands of L8 look decent (should be 142)

Re-run

  • redid L8 using common primer. Amplified by cycle 15-16 (stopped at 22, a bit late).
  • proceeded with gel cleanup.
  • ran gel with residue from PCR tube after running cleanup (low conc)
    lib8_fixed

Communication notes

  • write to Cornell
  • update Stanford
  • write to XZ – re: new collaboration

Data requests

  • sent volume-rg data to Marc M.R.
  • sent molecule lists data for docking models to same.
  • requested export to excel files, need to do today – processing, export from matlab to excel is slow. sample data for first 3 domains looks good.
Posted in Summaries | Comments Off on Monday, 03/08/16