Monday 08/03/15

9:15 am – 5:05 pm,

Goals

chromatin STORM

  • finish STORM session of L2F03 dat in Ph-KD condition
  • take bead movies, transfer data
  • start fitting movies after transfer completes
  • setup auto-transfer (?) for next time

Ph project

  • send Ph data on downsampling for Fig 1 graphs to NF an AW
  • analyze effects of down-sampling on fig 2 results

STORM2

  • new pixel size for 1.5x slider and 60x objective = 0.192 um (or 0.195 um)

Chromatin Project To Do list

  • live imaging
    • analyze new live imaging data from confocal
    • PCP imaging of telomeres (in U2OS?)
  • RNAi experiments
    • set up new RNAi for Pc(v2) and Ph-p + Ph-d
    • prep for sequencing Ph KD cells and WT cells.
    • repeat qPCR experiments for Ph KD — need more robust replicates
  • centromeric chromatin imaging
    • Design library for green regions
    • assemble and process existing data on green regions
    • image AATAT centromeric region in Kc (should be good live imaging target too)
  • PRE analysis
    • re-analyze PRE-density as a function of volume using new PREs, see if its a primary effect.
    • also compare difference from trend line with PRE density, see if its a secondary effect.
  • Hi-C analysis
  • Active chromatin analysis
    • correlate TSS density and difference from trend line
    • correlate expression level and difference from trend line
    • correlate insulator protein density and difference from trend line

Chromatin Project work

  • ordered CycB antibody
  • analyzing mmaple3-dCas9 data on Morgan
    • no obvious signs of telomere labeling
    • not a sharply defined nucleolous border
      mmaple_No_telos
  • working on analyzing confocal live imaging data: see post
Posted in Summaries | Comments Off on Monday 08/03/15

Exploring Fixation Effects 08/03/15

Confocal images of live and fixed cells with different fixation methods

Using automated image processing to ID effects on chromatin structure.

Time control
timeControl_FixEffects

MEOH fixed sample
postiveControl_shrinkage

FixEffects_MeOHcontrl

FixEffects_MeOH_scaleFactors FixEffects_MeOH_scaleFactorsGraph

Experiment vs Negative control
FixEffects_ExpVsNegFixEffects_scaleFactors FixEffects_scaleFactorsGraph

Switched from simple rescaling to feature finding using FIJI / MIJI

FixEffectsFeatureFinding

Posted in Chromatin | Comments Off on Exploring Fixation Effects 08/03/15

Sunday 08/02/15

11:00 am – 3:30 pm, 6:30 pm – 11:15 pm

STORM

  • STORM2 froze during the night (click error provided an out of frame crash in python — built in check doesn’t catch it.
  • debugged this with Bogdan, changed catch statement to check size of the object queried, not just the expected size of the image.
  • restarted imaging of Ph-KD L2F03 with fresh buffer
  • acquisition still looks good at movie 18. And rolling.
  • need to take z-beads and chromatin beads tomorrow before Colenso starts.

Planning

  • need to design and order new Green probes.
  • need to analyze existing green data.

MERFISH

  • figuring out parsing of new data schema
  • trying to process L12 two-color data for analysis with Pipeline 5 or updated pipeline 1.

Nuclei live imaging

  • took time lapse images of Hoechst stained nulcei (2 year+ expired DRAQ5 didn’t look that good at 1:10,000)
  • took images of mock fix (replaced growth media with more growth media)
  • took images of formaldhyde fixed cells
  • took images of MeOH fixed cells (clearly shrunk)
  • need to do some coding to analyze these.
    • probably worth some manual playing with the Fiji tools too.
  • some issues with Z-focus and x-y registration, largely sorted though.

Ph-Project

  • check that numbers don’t change much upon down-sampling
    Ph_downsampling_effects

Review

  • reading article, drafting comments of first impressions
  • very long methods section, reading imaging methods in detail
Posted in Summaries | Comments Off on Sunday 08/02/15

Thur 07/30/15

11:00 am – 7:30 pm, 9:30 pm – 10:45 pm

(9:00 am – 11:00 am volleyball practice)

Chromatin

Cell

  • plated Kc167 cells (in SFX) on glass
  • my more recent flask with the short Trypsin treatment is doing well.
  • the original passage with the longer Trypsin exposure is not looking so good.
  • tried removing Psc- cells by blowing (without Trypsin). works a little bit, not at all like with Trypsin.
    • added a little scraping an moved cells to new vial
  • tried imaging cells live labeled with Hoechst – doesn’t bleach much or blink
  • tried imaging cells live labeled with Draq5 – doesn’t bleach at all (or switch to dark state to blink)
    • tried both culture media and STORM BME imaging buffer.
  • Invitrogen has a number of other cell-permiable dyes: https://www.lifetechnologies.com/us/en/home/references/molecular-probes-the-handbook/probes-for-organelles/nuclear-and-chromosome-counterstaining-and-nissl-stains.html#head1

Cell cycle markers

  • CycA (DSHB)
  • phospho-H3 (M-phase specific) see here (fig 1, red)

Culturing Psc- cells

  • tried passage by scrapping — disaester, cells die
  • tried trypsin first spin looks good. No cells came down in PBS spin (sparse cells). Don’t look good on plates. I think I killed these.
Posted in Summaries | Comments Off on Thur 07/30/15

Protected: lab meeting: 07/31/15

This content is password protected. To view it please enter your password below:

Posted in Lab Meeting | Comments Off on Protected: lab meeting: 07/31/15

Wed 07/29/15

9:10 am – 8:00 pm, 9:30 pm – 12:00 am

To do

  • confocal imaging
  • design primers
  • re-read and submit review

Done

  • confocal imaging (no staining)
  • submitted review (done)
  • feedback for Hao on essay (sent)

Embryo staining

  • no signal with 37C hybe
  • to try next: 10% formamide, 2X SCC, 10% dextran sulfate, 37C

Working on Ph co-localization data

  • see notes
  • sent updates to NJ and AW
  • analyzing Ph-M co-colocalization Flag Ph

Chromatin project

  • analyzing conventional data
  • discussed approach
Posted in Summaries | Comments Off on Wed 07/29/15

Protected: Ph-Polymerization colocalization control

This content is password protected. To view it please enter your password below:

Posted in Chromatin | Comments Off on Protected: Ph-Polymerization colocalization control

troubleshooting hb stains

Purpose

  • to start MERFISH experiments in Drosophila embryos
  • Plan: use Biosearch probes to optimize RNA labeling using DNA probes
  • currently using 20mers directly labeled. These aren’t working.

Images from Shawn Little’s paper (Gregor lab)

Gregor_Hb_images

My RNA hb stains

zoom out on whole embryo, stained in green for hb
myHb_RNA_FISH_1

a different embryo with hb in red and an intronic reporter for a hb transgene (at a different insertion site on a different chromosome) in green
myHb_RNA_FISH

My DNA hb stains don’t work at all (following protocol from the Little et al Cell paper)

  • Not clear why
  • could repeat RNA stains again just to make sure everything is working alright. Not sure if my RNA-probes are still good after 6 years in the -20C but I can try.
  • try different hybe conditions (tried RT hybe, which is what appears to be what Little et al use, tried 37C hybe).
  • could try different hybe buffers
  • I recall Raj reported not being able to get Drosophila embryos to work with his 2008 protocol
Posted in Microscopy | Comments Off on troubleshooting hb stains

Tuesday 07/28/15

9:30 am – 7:30 pm, 9:30 pm – 11:45 pm

Ph polymerization

  • reviews back
  • writing reply
  • goal to respond this week

to do

  • Ph-Flag / Ph co-localization data
  • DNA FISH long range contact frequency (hold off)

Live imaging of chromatin

  • dCAS9 for Drosophila sequence
  • transfection vector for Drosophila

Reagents

  • dCAS9-fused to Fok1 (need to add mmaple3) from addgene (here)
  • repeat sequences:
    • the “dodeca repeat” ACGGGACCAGTACGG
    • the “359 repeat” GGGATCGTTAGCACTGGTAATTAGCTGC,
    • the “AACAC” repeat: AACACAACACAACACAACACAACACAACACAACAC
    • the AATAT repeat: AATATAATATAATATAATATAATATAATAT
      DrosophilaRptLocations
Posted in Summaries | Comments Off on Tuesday 07/28/15

Monday 07/27/15

9:20 am – 10:00 pm

Reading

  • I’m looking for new insights to improve our genome wide prediction of PREs
  • Schuttengruber et al Cell Reports 2014 on PRE evolution
  • Zheng et al 2012 develop computational predictor
    • this uses ChIP data to ‘validate’ predictions
    • ChIP/damID data from Tolhuis et al (225 genes), Schwartz et al (176 genes), and Schuettengruber et al (215 genes) show only ~30 % agreement (38 genes)
    • they remove ‘duplicate genes’ from list. NO!! I want to count multiple PREs per gene as multiple PREs. don’t remove the “duplicates”, they
    • I want to see ChIP data used as input and PRE genetic tests used as validation.
    • ROC curves for this predictor outperform previous model (jPREdictor) but are still not very far off the diagonal.
  • back to Schuettengruber…
  • Schuettengruber 2014 predict 379 conserved sites within PcG domains using cross-species ChIP-seq K27me3, K4me3 (for TSS), Pc and Ph.
  • downloaded table
  • NOTE: should plot with and without peaks corresponding to TSS’s for estimated PcG density.
  • nice paper. weak, multi-component interactions specify PREs / PcG silencing, highly conserved through D. vir.
  • also has higher res Hi-C than previous Sexton et al 2012, and focuses on PcG regions.
  • claim PHO sites preferentially contact each-other uniquely in the context of PcG domains
  • show predictive correlation and KD evidence that PRC1 recruits Pho (in Ph mutants). Specifically reduce Pho binding at its PcG sites but not its non PcG domain sites.
    • mutants correlate Pho binding and Ph motif within PcG domains but wt does not (supporting cooperative recruitment model).
    • outside of PcG context, Pho co-localizes with CP190 and BEAF32

Review

  • finish refereeing paper and submit recommendations (due tomorrow)

Chromatin project

for analysis of deviants, comparison to other features

  • getting D mel embryonic gtf file to run cufflinks
  • SAM format specs
  • SAM files need to be sorted first by SAMtools see thread.
  • data is not presorted the way cufflinks needs, (should be alpha-numeric by chromosome).
    SAMfileNotSorted
  • sorting using this command:
    sort -k 3,3 -k 4,4n hits.sam > hits.sam.sorted
  • (From BioSTAR: The code just means to sort on column 3, then by column 4(numerically) of the hits.sam file and print to hits.sam.sorted)
    e.g.
    sort -k 3,3 -k 4,4n /n/home05/boettiger/Genomics/Data/GSE18040_Dm_KC167.sam > /n/home05/boettiger/Genomics/Data/Dm_Kc167.sam.sorted 2> /n/home05/boettiger/Genomics/Data/errorsSort_KC167.txt
  • best to test these things on small data sets
  • wrote matlab command to build smaller dataset (ParseSAMdata_150727.m)
  • sort command works as expected on this.
  • this runs properly through cufflinks (tested small version)
  • sorting the whole 3Gb data set on Odyssey with this command is very slow…
  • sorting finished, running cufflinks still failed. Upset about ordering of chr M and chr U in the SAM file (neither of which I need!!)
    • Moreover this file IS sorted correctly, U is after M (and before X and Y) so shut up and keep analyzing!
    • 'current' 'hit' 'is' 'at' 'U:3652,' 'last' 'one' 'was' 'at'
      'M:18987'
  • samtools sort doesn’t work on sam files, only bam files (so much for “sam”tools).
  • file REFUSES to convert to BAM becuase there is no @SQ lines in the header.
  • okay, so let’s sort by hand and remove the ‘M’s and ‘U’s using matlab
  • matlab textscan reads this into inefficient cell arrays, which are now using ~60 Gb (yes gb) just to textscan in a ~4 Gb text file.
  • Bogdan is going to fix this in Python
  • after some more frustration, data ran correctly.

RNAi

qPCR

  • setting up qPCR of last weeks PPPES (1 and 2) and Ph KD samples, along with corresponding mocks.
  • assay for 3 cntrl genes, 3 PcG targets, + Pc and Ph-p.
  • column order (cDNA): PPPES 1, PPPES2, Ph-Kd, Ph-Kd-mock, PPPES-mock, prior-mock
  • row order (primers): alpha-tub, act, gapdh, Pc, Ph-p, Antp, Abd-B, en
  • flipped primer labels. oops. fortunately I sorted by expression so it’s easy to spot.
    qPCR_plate_150727 qPCR_plate_CI_bounds_150727

Embryo staining

  • check samples on confocal
  • no staining at all.
  • maybe 37 C is necessary.
  • previous results look vaguely more encouraging
    NoStainingEarly NoStainingEarly_Q RNA_FISH_with_DNAprobes_1 RNA_FISH_with_DNAprobes_overlay

Issues with protocol

  • Temperature not mentioned. I assume this means RT but I find that a bit strange for hybes
  • probe sequences, probe length, and probe number not mentioned

Other

  • gave 8 uL of 40ng/uL YW gDNA to AC.
Posted in Summaries | Comments Off on Monday 07/27/15