coding

Polishing MERFISH code for public release.

Plan

  • take 140 gene library, create short fasta of just complete genes, run it through Launch OligoArray
  • add parse OligoArray (as a function) into this script
  • add assemble secondaries and target regions into as a function into this script (it mostly is a function)
  • I think this should be a separate library building folder.
Posted in Software Development | Comments Off on coding

Wednesday 02/03/16

10:00 am – 5:00 pm

Probe synthesis

  • start synthesizing 2kb probes (with SW secondaries and Fast secondaries)
  • running T7 reaction O/N.

To do

  • test SDS treatment of embryos
  • test 2 kb probes (scope time on Friday evening).

Results from yesterday

  • L7 library on embryos
    L7_B1

AfterToe1

L7_B2_focusChanged

Other items

  • literature review of recent titles and abstracts
  • correspondence to Anna Oddone about fiducials
  • correspondence to Guy about STORM imaging.
  • approval for purchases from my DR funds via the P-card.
  • minor corrections to requested quotes for HHMI for new scope system
    • for the 560/647 quote and 750 quote, change company name to Howard Hughes Med. Inst.
    • Split 560 and 647 onto 2 different quotes, both need to be Change company name to Howard Hughes Med. Inst.
    • Newport: The quote needs to say bill to HHMI
    • Separate quote without the turret
  • sent new quotes to XZ
Posted in Summaries | Comments Off on Wednesday 02/03/16

Thursday 02/04/16

12:00 pm – 6:30 pm

(10:00 am – 12:00 pm working remotely on library).

Library prep

  • updated 15 kb en library to use F primer L6F5 with L6R2 instead of F1, which I already used in lib7
  • ordered en 15 kb library along with probes for BB at 12K scale from CustomArray
  • also sent MC our recent paper on chromatin imaging
  • Library name: L8_SI6.fasta

    • library organization:

    % 3′ P4-Alexa405, A647-Steven,
    % 5′ FwdIndex, cy3-commonRT, TruncStevenSecondary, targetRegion, RevIndex
    % 20-bp, 20 bp, 20 bp, 42 bp, 20 bp, total: 122

Embryo staining

  • label embryos

New libraries in consideration

  • small MERFISH library to drosophila embryonic genes
  • eve locus at 2 kb resolution
  • cut locus at 5 kb resolution

Probe synthesis

  • continued RT for 2kb resolution probe library against BX-C region
  • updating protocol

Other

  • booked flight back from SFO to BOS on Sat Mar 5th.

Received

  • L7S (L7-secondary) arrived today
  • S1-L7common fusion arrived today

Microscope building

  • Hsuan offers to help. great!
Posted in Summaries | Comments Off on Thursday 02/04/16

Tuesday 02/02/16

8:45 am – 10:40 pm

schedule

  • Rinse out probes, set up primary hybe for bit 1 for embryo staining experiment tracing BX-C
  • Wu lab group meeting
  • meeting with Scolnick at Broad
  • Garner seminar on academic advice (see protected notes)
  • continuing hybridization experiment
  • Norcea seminar on running a lab (see protected notes)
  • continuing hybridization experiment
  • work on equipment cycle request for new scope

Embryo staining

  • RNA template non-degradation was indeed the problem, beautiful staining in bit 1.
  • bit 1 removes nicely in 20 min.
  • adding bit 2, background still very high after 5 min wash, running longer wash, more fluid changes.
  • imaging 4% 647 laser at 150 mW.
Posted in Summaries | Comments Off on Tuesday 02/02/16

Protected: Dan Norcea: running a lab

This content is password protected. To view it please enter your password below:

Posted in Seminars | Comments Off on Protected: Dan Norcea: running a lab

Protected: Ethan: Packing your parachute: Career Advice

This content is password protected. To view it please enter your password below:

Posted in Seminars | Comments Off on Protected: Ethan: Packing your parachute: Career Advice

Monday 02/01/16

9:05 am – 7:30 pm, 8:15 pm – 11:40 pm

Imaging

  • testing control L4E24 embryos. stains look great.
  • compare to L7 embryos — no staining.
  • ran series removing S2 with toe-hold 5 bp. Looks excellent.

Troubleshooting

  • Gel tests
    • try to anneal probe and secondary on bench, no cells. Test if still bound on gel.
    • 5% PAGE gel. ran too long and gel was a bit too old
    • smears suggest partially degraded RNA slowing down template to various degrees
  • found the likely problem — 8 mM NaOH instead of 1 M NaOH in the RNA degradation step.
  • re-ran digestion, re-ran probe clean-up
  • re-ran hybridization

Ordering

  • S1rc + L7 common = GCGATGGTAGACGGCGTATGAATTCGGCAGAC GACCCGTCAGGATAGGCCCT

Microscope building prep

  • requesting quotes from MPB, Nikon, Coherent, and Newport

To do

  • write microscope justification
  • book flights back from San Fran
  • diagnostic gel
  • detailed labeling of samples
Posted in Summaries | Comments Off on Monday 02/01/16

Sunday, 01/31/16

6:00 pm – 7:00 pm

Embryo staining

  • just going for labeling — set heat block to 100C
  • spec new library:
  • label just new library, 3 uL in 20 uL buffer.
  • control embryo, restain Friday’s failed sample with L4E24 P2/S2
Posted in Summaries | Comments Off on Sunday, 01/31/16

Protected: Lab Meeting 01/29/16

This content is password protected. To view it please enter your password below:

Posted in Lab Meeting | Comments Off on Protected: Lab Meeting 01/29/16

Friday 01/29/16

9:00 am – 7:15 pm

Meetings

  • lab meeting (see notes)

embryo staining & imaging

  • stained BX-C locus with Bit 1 (9:00 am)
  • rinsed out stain
  • broke coverslip 1 after it detached from the plastic petri dish before the the nail polish set (2 minutes was not enough)
  • started staining slide 2, 2:00 pm
  • testing stage
  • no staining (at least not near as good a last time with the 15 kb probes).
  • stained with bits 1-15 minus 3, (was going to have 3 as a cy3 control). This gives substantial nuclear background and potential faint spots.
  • maybe try more stringent wash conditions

Troubleshooting planning

  • ordered a cy3 primary (this will help troubleshoot both the probe making and the primary staining).

New stains

  • started prep of 2 new coverslips
  • ran through complete coverslip prep protocol, including Triton, LN2, Hcl and RNase. now in 50% formamide 2x SCC at 4C.

STORM5

  • steve doesn’t work: hal doesn’t save files in the correct directory with the correct name.
  • hal doesn’t save position in in the inf file. This makes tracking / returning to position quite difficult. Can use steve to record stage position.

Microscope building

  • got quotes from GE for lasers. started new Microscope building project folder
  • started excel doc to project costs. should contact Hazen.
Posted in Summaries | Comments Off on Friday 01/29/16