Friday 01/29/16

9:00 am – 7:15 pm

Meetings

  • lab meeting (see notes)

embryo staining & imaging

  • stained BX-C locus with Bit 1 (9:00 am)
  • rinsed out stain
  • broke coverslip 1 after it detached from the plastic petri dish before the the nail polish set (2 minutes was not enough)
  • started staining slide 2, 2:00 pm
  • testing stage
  • no staining (at least not near as good a last time with the 15 kb probes).
  • stained with bits 1-15 minus 3, (was going to have 3 as a cy3 control). This gives substantial nuclear background and potential faint spots.
  • maybe try more stringent wash conditions

Troubleshooting planning

  • ordered a cy3 primary (this will help troubleshoot both the probe making and the primary staining).

New stains

  • started prep of 2 new coverslips
  • ran through complete coverslip prep protocol, including Triton, LN2, Hcl and RNase. now in 50% formamide 2x SCC at 4C.

STORM5

  • steve doesn’t work: hal doesn’t save files in the correct directory with the correct name.
  • hal doesn’t save position in in the inf file. This makes tracking / returning to position quite difficult. Can use steve to record stage position.

Microscope building

  • got quotes from GE for lasers. started new Microscope building project folder
  • started excel doc to project costs. should contact Hazen.
Posted in Summaries | Comments Off on Friday 01/29/16

Thursday 01/28/16

9:40 am – 5:00 pm

Goals & progress

  • prep and stain embryos with new L7 library. -> DONE
  • order food for group meeting. -> DONE.
  • pick up suit for interviews. -> DONE.
  • work on equipment lists. -> Extracted parts list for STORM5
  • get estimates of microscope room specs. -> contacted Mike Paterno
  • contact UCSF about dates -> Scheduled: Mar 4th and 5th. (Thur + Fri).
  • order Alexa 647 labeled probe complimentary to L7 (thought I did this earlier but check records today and not ordered).

Experiments

  • L7 library staining embryos (3 uL library to 25 uL hybe dilution buffer). Stained 2 coverslips.
  • denatured with block set to 90C. Block reading 78-80C during incubation once cold glass slides and water are added. Thermometer reading 85C.

Image results

  • RNA probes clearly labeled better than smFISH DNA probes for confocal imaging.
    smFISH hb-647

hbEmbEarly hbEmbEarlyZoom hbEmbLate hbEmbLateZoom

smFISH RNA probes with antibody

snaDig_2yr snaDig_2yrB

Code

  • start writing (and streamlining) code for an engrailed locus library.

maintenance stuff

  • started new box of common MERFISH supplies for team
  • started new excel sheet for logging my lab purchases
  • created new excel sheet indexing all parts purchased for STORM5
Posted in Summaries | Comments Off on Thursday 01/28/16

Protected: Wednesday 01/27/16

This content is password protected. To view it please enter your password below:

Posted in Summaries | Comments Off on Protected: Wednesday 01/27/16

Tuesday 01/26/16

11:00 am – 6:30 pm

embryo smFISH optimization

  • testing quality of methanol stored embryos
  • from yesterday:
    • 6 mo and 2 year embryo batches stained with my in situ protocol I optimized in the Levine lab
    • 6 mo sample directly labelled with Stellaris FISH probes against hb.
  • hot washes
    • protocol with dig-probes: 3x wash 30 min each at 55, in hybe buffer.
    • following Xu et al: 3x wash, 30 min each at 30C, 2x 10 min each in 2x SSCT
  • no Roche western blocking soln in stock, will have to use BSA.

Testing sample

  • took some confocal images of the Xu Hb-647 probes, with narrow pinhole and some zoom, single molecule images look detectable
  • the antialiasing built into this system is unfortunate.
  • saved some embryos to test in cryo section. Should schedule some sectioning time later this week.
  • lets try these systems on our scopes tomorrow.

Probe making with Hazen

My L7 probes:

  • mix: 80 uL reactions, 30 uL RNA, 16 uL buffer, 8 uL dNTPs, 6 uL 100 uM primer, 8 uL Maxima, 8 uL RNasin.
  • did both newly arrived labeled and unlabeled primers
  • Toe-hold probes arrived today, placed in my -20C. Bogdan will send layout of probe/well by email

HB collaborative project

  • set up RT reaction in 40 uL.
  • separate reactions for cy3 labeled P2 and 405 labeled P4. (should make sure Hazen has these IDs).
  • Ran through RNA degradation step. didn’t get to gel — will save for tomorrow.
  • wrapped gel in plastic wrap and put at 4C, turned off water bath, will run tomorrow.

Discussion with BB on setup for manual seq imaging

  • Readout buffer: at RT, 40% formamide, 10% dextran sulfate, in 2x SSC + 1:1000 of 100 uM readout probe, 20-25 min incubation, use 150 uL
  • 30% formamide in 2x SSC 5-10 min, 400 uL
  • steven’s secondaries are in green box in downstairs -20C next to my probe template plasmids.
  • im buffer as in MERFISH, keep in 4C, 200 uL to image. (Glox under oil).

To order

  • I’m a bit short on some of the reagents for an ideal test.
  • ordered new Roche western block, ribonucleoside vanadyl complex (RVC), RNase free BSA,
  • discuss with BB ordering for new fluidics system.
Posted in Summaries | Comments Off on Tuesday 01/26/16

Monday 01/25/16

9:40 am – 7:00 pm

Reading

  • Recommendations for junior scientists: https://drmaltman.wordpress.com/2014/09/17/10-simple-steps-to-building-a-reputation-as-a-researcher-in-your-early-career/
    • I don’t have time to make it to the lecture on this today, but some simple suggestions worth bearing in mind from Micha Altman
    • I should probably update my website at somepoint

Goals

  • probe synthesis – T7 reactions
    • still waiting for toehold probes to arrive, so there’s no rush on this.
    • also waiting for labeled version of RT primers to arrive, though I could do a test with the unlabeled version.
  • embryo smFISH optimization, try Golding protocol.

Thoughts for the day

  • can I adapt kindle fire as a cheap, web enabled, bench-top lab notebook device?
  • wrote to find out if I have any money left in my fellowship supply fund to test this.

Experiments

Embryo smFISH

  • continuing probe making
  • precipitate snail-dig probe, dry, resuspend in hybe buffer
  • running traditional RNA FISH stain (from xyelenes forward).
  • 5 nmol in 100 uL, target is 100 nM total probes (2 nM per probe)
    • so 1 in 500 uL. Try at double, 2 in 500 uL.
  • tried and true Levine lab method: using new dig-RNA. 4 uL RNA in 200 uL. Tested on both embryo samples.
    • incubating in shaker at 55C O/N
  • Xu method, didn’t have tRNA, ribonucleoside vanadyl complex, or RNase free BSA
    • used instead ssDNA and heparin, with 10% dextran sulfate
    • incubating at 30 C O/N (no shaker available, not as necessary with dextran sulfate, embryos don’t settle quickly).

Probe making

  • set up T7 reactions for 2x sample of L7 library and for all probes 1, 2, and 4 with Hazen (+ a positive control)
  • sample order: 1, 2, 4, gap, L7, L7, positive control.
Posted in Summaries | Comments Off on Monday 01/25/16

Protected: Friday 01/22/16

This content is password protected. To view it please enter your password below:

Posted in Summaries | Comments Off on Protected: Friday 01/22/16

Protected: lab meeting, 01/22/16

This content is password protected. To view it please enter your password below:

Posted in Lab Meeting | Comments Off on Protected: lab meeting, 01/22/16

Thursday 01/21/16

10:10 am

(back from UCSD interview)

Probe synthesis

  • L7 10kb BXC library — amplifying
    • amplifies and saturates about cycle 24 (ran 27 cycles which was probably extra but should still make good probe)
  • purified amplification, ready for T7 reaction
  • don’t have new labeled RT primer in yet, need to wait to run RT reaction :(
Posted in Summaries | Comments Off on Thursday 01/21/16

Friday 01/15/16

9:15 am – 5:00 pm

Tasks

  • collect and match primers for DSB library
  • training GN on AO STORM3
    • Boran helped review protocol: MicAO software (not AO folder)
    • use hal to select record and save frames and then use AO software to Play from the target folder to read in frames and compute mode optimization
Posted in Summaries | Comments Off on Friday 01/15/16

Thursday 01/14/16

9:30 am – 7:00 pm

Our work, “Super-resolution imaging reveals distinct folding for different epigenetic states” is now out in Nature!

Our work, “Chromatin topology is coupled to Polycomb Group protein subnuclear organization” is now out in Nature Communications

Tasks

  • lab cleaning — clean cold-room.
  • catching up on emails after interview-visit.
  • had some broken links on software page, updated these.
  • Sorting out reimbursement paperwork for EMBO conference (Lisa is contact)
  • order primers
    • T7 = ‘TAATACGACTCACTATAGGG’;
    • L7_FwdCommon: ACCTCCGTTAGACCCGTCAGGATAGGCCCT
    • L7_Rev1, BX-C steven-probes, 10kb pieces: seqrcomplement(‘CCTTCCGACGGTCTAACCGA’) TAATACGACTCACTATAGGG TCGGTTAGACCGTCGGAAGG
    • L7_Rev2, BX-C steven-probes, 2kb pieces: seqrcomplement(‘AGGCCGGGCGCGGTATGGTT’) TAATACGACTCACTATAGGG AACCATACCGCGCCCGGCCT
    • L7_Rev3, BX-C fast probes, 10kb pieces seqrcomplement(‘GGGAGGTACGCTCATGTGCT’) TAATACGACTCACTATAGGG AGCACATGAGCGTACCTCCC
    • also designed toe probes and ready to order (waiting for O-card to recharge first though).
  • catching up on literature.
Posted in Summaries | Comments Off on Thursday 01/14/16