Monday, 03/08/16

Posted on March 7, 2016 by admin

10:00 am – 6:00 pm,

New Library synthesis

  • chr-L8 (en-locus)
    • T7 L6E3_R primer_232 TAATACGACTCACTATAGGG TTGCGCGAGACCAACGTACG
    • L6E1_F primer_226 CCGTACGTCGAGTCGGGTCG
    • Was: T7 L6E2_R primer_230 TAATACGACTCACTATAGGG TGATCATCGCTCGCGGGTTG, swapped out for L6E3_R to avoid cross-talk with DSB-lib
  • Also doing L7 10 kb and 2 kb (to make in cy3).

per reaction

  • 25 uL enzyme-master
  • 2.5 uL 1:40 library
  • 2.5 uL F
  • 2.5 uL R
  • 2.5 uL EvaGreen
  • 10 uL ddH2O

Master

  • 100 enzyme + 10 Evagreen + 40 ddH2O, 40 ea.
  • sample order: tab, L8 (en), L7-10kb (BXC), L7-2kb (BXC)
  • out of 10x Sodium Borax (Na-Borax). 10g Sodium Tetraborate in 1 L ddH2O

Column cleanup

  • per instructions, on DCC-5
  • ran gel. Order: L8a, L7 10 kb, L7 2 kb, L8 try 2
    lib7and8_template_labeled_160308

Observations: L8 failed both times (amplified up through cycle 30 first time, didn’t start until cycle 25, started around cycle 22 when run at 62C annealing instead of 65C for second run, still stopped at cycle 30). L8 probes amplified by cycle 25 (later than last time). Bands of L8 look decent (should be 142)

Re-run

  • redid L8 using common primer. Amplified by cycle 15-16 (stopped at 22, a bit late).
  • proceeded with gel cleanup.
  • ran gel with residue from PCR tube after running cleanup (low conc)
    lib8_fixed

Communication notes

  • write to Cornell
  • update Stanford
  • write to XZ – re: new collaboration

Data requests

  • sent volume-rg data to Marc M.R.
  • sent molecule lists data for docking models to same.
  • requested export to excel files, need to do today – processing, export from matlab to excel is slow. sample data for first 3 domains looks good.
Posted in Summaries | Comments Off on Monday, 03/08/16

About my notebook

This is my lab notebook.  It is how I organize and document my scientific research on a day-to-day basis.  It is intended primarily for my personal use as a permenant record of my work.

Unlike traditional notebooks, it is text searchable.  All notes are listed in appropriate categories, and I can easily rearrange my notebook to display only posts relating to a particular category.  Research images, from gel photos to simulation results to draft figures for manuscripts are included as images, and automatically become part of a date-tagged browsable image collection.  Hyperlinks let me connect protocols and references.

My notebook also automatically tracks my code development, through RSS feed forwarded by my code repository in Github.  The notebook additionally keeps track of what I’m reading, through RSS feed run through Mendeley (when the API works).

In addition to being more convenient, I hope this notebook contributes in a small way to making Science more Open.  Much of what we do as academic researchers is never published, and these findings (though funded generally by tax payer dollars) are forever lost to the world.  Much of what is published is only available in expensive, specialized journals which most of the world does not have access to.  It is my hope, and that of the Open Science Movement, that the technologies of Web2.0 enable us to move to a world where this is no longer the case.  In an open or partially open web hosted notebook, all the unpublished ideas and discoveries can still be easily released to the world, where they are text-searchable and easily discoverable, so that other researchers can benefit from them.

Unpublished information that I am not yet ready to share with the world at large is protected by passwords.  These can be shared with individual collaborators of mine, and removed once the relevant work is published.

I have received much inspiration, encouragement, and technical support from several individuals.  Most importantly, my brother Carl Boettiger, who is a leading figure in the Open Science Movement at Davis, and keeps a Open Notebook here.

Posted on February 27, 2016 by admin | Leave a comment

Protected: Friday 02/26/16

Posted on February 26, 2016 by admin

This content is password protected. To view it please enter your password below:

Posted in Summaries | Comments Off on Protected: Friday 02/26/16

Protected: Alex Pollen — human vs chimp brain organization

Posted on February 25, 2016 by admin

This content is password protected. To view it please enter your password below:

Posted in Seminars | Comments Off on Protected: Alex Pollen — human vs chimp brain organization

Thursday, 2/25/16

Posted on February 25, 2016 by admin

Seminars

  • Alex Pollen seminar (see notes)

Microscope building

  • HHMI equipment cycle equipment granted was 3 MPB lasers (560, 647, 750), Hamamatsu camera, Nikon microscope body w/ 8K of extras, Coherent 488 laser
  • submitted separate quote addressed to Harvard for
    • optics table + legs
    • 405 laser
  • need quotes for
    • AOTF
    • quadview
    • piezo
Posted in Summaries | Comments Off on Thursday, 2/25/16

Protected: Monday 02/22/16

Posted on February 22, 2016 by admin

This content is password protected. To view it please enter your password below:

Posted in Summaries | Comments Off on Protected: Monday 02/22/16

Friday 02/19/16

Posted on February 19, 2016 by admin

9:00 am – 5:00 pm

Tasks

  • lab meeting 10 am – 12:30 pm (see notes)
  • FISH with Hazen — prepped cells up to hyb step, should be in formamide by tonight
  • Reply to request from Biteen lab for code help
  • Phone interview with UCSD Epigenomics and chromatin, joint search
  • Receipt for HMS visit
  • recommend authors/papers/subjects for Ann Rev Biophys for XZ (see email)
  • got schedule for cornell visit

To do still

  • schedule caltech flights
  • NE Dev Bio application and abstract (?)
Posted in Summaries | Comments Off on Friday 02/19/16

Protected: lab meeting 02/19/16

Posted on February 19, 2016 by admin

This content is password protected. To view it please enter your password below:

Posted in Lab Meeting | Comments Off on Protected: lab meeting 02/19/16

Protected: thoughts on improving my chalk talk

Posted on February 18, 2016 by admin

This content is password protected. To view it please enter your password below:

Posted in Research Planning | Comments Off on Protected: thoughts on improving my chalk talk

Thursday 09/18/16

Posted on February 18, 2016 by admin

9:30 am – 9:00 pm

Tasks

  • reply to MIT IMES / Physics
  • reply to Caltech
  • submit patent signatures
  • Discussion with Hsuan – microscopes and plans
  • Discussion with BB
    • using common label as a fiducial for XYZ corrections
    • validate if I have a Cy3 common for STORM activation on L7 – yes arrived today.
    • parts not all here for flow system: waiting for needles and power-supplies (Hamilton not stock power supply, ordered from Amazon).
    • need more scope time for experiments.
    • test brightness on current data

Still to do

  • NEBSB abstract?

MERFISH code

  • final debugging of library building code in test mode.
  • annotating code
  • push back to repo
  • test JM’s code scripts
    • error on read info file — bin files found but inf files not bound
    • line 33 of analysis_script calls parameters.codebook, but parameters.codebook is not defined.
    • Changing this to parameters.codebookPath (defined on the previous line), lets the CodebookToMap function run.

Scope building

New quotes

  • AOTF
  • Quadview
Posted in Summaries | Comments Off on Thursday 09/18/16