Alistair's Lab Notebook

10:07 am –

Tasks

• Discussion about super-resolution of individual membrane proteins (EL lab).
• Reply to request for data from JM Victor.
• Project updates with BB. Need to contact LM team about explaining model.
• Discussion on quantifying nuclear structures with new postdoc (see email). Promised to send matlab code.
• Reviewing research interests and publications from HMS prior to this week’s meetings.
• Sent abstract to Cornell for discussion
  • minor updates to slides
  • reading Schrodinger’s What Is Life (a useful context for this talk I think).
  • introduction still needs substantial work.
• Working on public domain code for MERFISH

9:30 am –

communication

• discussion with Paul on MERFISH

Microscope building

• updating parts list
• discussion with Hsuan on plans
• see shared dropbox folder and shared excel files (need to link in)

Interview Prep

• prep for Salk and MCB interviews

10:00 am – 5:00 pm

Probe synthesis

• start synthesizing 2kb probes (with SW secondaries and Fast secondaries)
• running T7 reaction O/N.

To do

• test SDS treatment of embryos
• test 2 kb probes (scope time on Friday evening).

Results from yesterday

• L7 library on embryos
  

Other items

• literature review of recent titles and abstracts
• correspondence to Anna Oddone about fiducials
• correspondence to Guy about STORM imaging.
• approval for purchases from my DR funds via the P-card.
• minor corrections to requested quotes for HHMI for new scope system
  • for the 560/647 quote and 750 quote, change company name to Howard Hughes Med. Inst.
  • Split 560 and 647 onto 2 different quotes, both need to be Change company name to Howard Hughes Med. Inst.
  • Newport: The quote needs to say bill to HHMI
  • Separate quote without the turret
• sent new quotes to XZ

12:00 pm – 6:30 pm

(10:00 am – 12:00 pm working remotely on library).

Library prep

• updated 15 kb en library to use F primer L6F5 with L6R2 instead of F1, which I already used in lib7
• ordered en 15 kb library along with probes for BB at 12K scale from CustomArray
• also sent MC our recent paper on chromatin imaging

• Library name: L8_SI6.fasta

  • library organization:

  % 3′ P4-Alexa405, A647-Steven,
  % 5′ FwdIndex, cy3-commonRT, TruncStevenSecondary, targetRegion, RevIndex
  % 20-bp, 20 bp, 20 bp, 42 bp, 20 bp, total: 122

Embryo staining

• label embryos

New libraries in consideration

• small MERFISH library to drosophila embryonic genes
• eve locus at 2 kb resolution
• cut locus at 5 kb resolution

Probe synthesis

• continued RT for 2kb resolution probe library against BX-C region
• updating protocol

Other

• booked flight back from SFO to BOS on Sat Mar 5th.

Received

• L7S (L7-secondary) arrived today
• S1-L7common fusion arrived today

Microscope building

• Hsuan offers to help. great!

8:45 am – 10:40 pm

schedule

• Rinse out probes, set up primary hybe for bit 1 for embryo staining experiment tracing BX-C
• Wu lab group meeting
• meeting with Scolnick at Broad
• Garner seminar on academic advice (see protected notes)
• continuing hybridization experiment
• Norcea seminar on running a lab (see protected notes)
• continuing hybridization experiment
• work on equipment cycle request for new scope

Embryo staining

• RNA template non-degradation was indeed the problem, beautiful staining in bit 1.
• bit 1 removes nicely in 20 min.
• adding bit 2, background still very high after 5 min wash, running longer wash, more fluid changes.
• imaging 4% 647 laser at 150 mW.

9:05 am – 7:30 pm, 8:15 pm – 11:40 pm

Imaging

• testing control L4E24 embryos. stains look great.
• compare to L7 embryos — no staining.
• ran series removing S2 with toe-hold 5 bp. Looks excellent.

Troubleshooting

• Gel tests
  • try to anneal probe and secondary on bench, no cells. Test if still bound on gel.
  • 5% PAGE gel. ran too long and gel was a bit too old
  • smears suggest partially degraded RNA slowing down template to various degrees
• found the likely problem — 8 mM NaOH instead of 1 M NaOH in the RNA degradation step.
• re-ran digestion, re-ran probe clean-up
• re-ran hybridization

Ordering

• S1rc + L7 common = GCGATGGTAGACGGCGTATGAATTCGGCAGAC GACCCGTCAGGATAGGCCCT

Microscope building prep

• requesting quotes from MPB, Nikon, Coherent, and Newport

To do

• write microscope justification
• book flights back from San Fran
• diagnostic gel
• detailed labeling of samples