Tag Archives: literature

Friday 05/16/14

Posted on May 16, 2014 by admin

Chromatin Project Analyzing E06+ E07 data: chr2R:19726615-19888410__YELLOW_D12 a + b 4Tb hard-drive in Kangaroo mount died. All data from F03-F02 and F04-F02 lost. Drive recovery services probably not worth it. Damn it. chkdsk ‘recovered’ the files by deleting all the … Continue reading →

Posted in Summaries | Tagged | Comments Off on Friday 05/16/14

Tuesday 02/04/2014

Posted on February 4, 2014 by admin

11:00a – 8:00p, 9:30p – 10:30p Ph project Manuscript writing working on model section finished description of first model (on-rate or off-rate limited) finished writing description of second model, ~3:30p, (chromatin availability limited) working on methods section wrote description of … Continue reading →

Posted in Summaries | Tagged , , | Comments Off on Tuesday 02/04/2014

Friday 01/31/14

Posted on January 31, 2014 by admin

10:50a – 11:50p Goals Today Order primers for sequencing work on Ph manuscript finish hybes to test sample age image F03F04 samples Deep sequencing 2 probes to order with sequencing indices D12 (375kb) GTGTCGCGTCGGCCAGAAAC F11 (180kb) AGGACATTCGCGGCTTTCAG G09 (76kb) CGTCGCGTTGGATTCAAGAG … Continue reading →

Posted in Summaries | Tagged , , , | Comments Off on Friday 01/31/14

Monday 12/30/13

Posted on December 30, 2013 by admin

9:20a -7:00p Goals Analyze 2-color STORM data test out new image-writers for hal Getting started Monet windows explorer froze and got killed. Requires restart. Finish up notes from yesterday, add gel images to notebook. STORM attempted software update to do … Continue reading →

Posted in Summaries | Tagged , , | Comments Off on Monday 12/30/13

Sunday 12/29/13

Posted on December 29, 2013 by admin

9:00a – 12:15a Goals Write to Ajaz about new plans Read in _oligo.txt files and analyze probe distributions STORM G1-G2 Start analysis of F12-G01 and F12-G11 data continue work on STORMrender Manual Literature Reading Kieffer-Kwon et al Cell 2013. link … Continue reading →

Posted in Summaries | Tagged , , , , | Comments Off on Sunday 12/29/13

Thursday 07/11/13

Posted on July 11, 2013 by admin

10:00 A – 7:00P, 8:30P-10:00P STORM Finish O/N run of PhM-flag-488, Ph-647 take bead images transfer data to ProRAID Set up analysis to run on Cajal Embryo in situs wash out probes check staining: All embryos washed off! 1 tiny … Continue reading →

Posted in Summaries | Tagged , , | Comments Off on Thursday 07/11/13

Wednesday 05/08/13

Posted on May 8, 2013 by admin

9:30 A — Probe making pool digests aliquot out test DNA: 1 uL digest DNA, 3 uL TBE, 1 uL 6x loading dye + 12x gel green, 5 uL formamide with 5% 5M EDTA Pour new 16% urea PAGE gels … Continue reading →

Posted in Summaries | Tagged , , , | Comments Off on Wednesday 05/08/13

Tuesday 05/07/13

Posted on May 7, 2013 by admin

9:25 A -5:50 P Ph FLAG Processing confocal images of Ph data updated ImageShop / ExtractLSM to fix bug in multi-position loader. Ph FLAG discussion / comments: post Literature Pirrotta Insulators target active genes to transcription factories and polycomb-repressed genes … Continue reading →

Posted in Summaries | Tagged , | Comments Off on Tuesday 05/07/13

Monday 01/07/13

Posted on January 7, 2013 by admin

9:30 A – 8:30P, Probe making Emulsion PCR of engrailed region probe at Wu lab.   Final library concentration 16 ng/uL, in 14 uL.  Should PCR amplify once. Brian will run test PCR and test gel to check library quality … Continue reading →

Posted in Summaries | Tagged , , | Comments Off on Monday 01/07/13

Wednesday 12/12/12

Posted on December 12, 2012 by admin

10:30 A – 7:30P, Data analysis Analyzing Hp1a centromere data Labeling density still somewhat low, centromere certainly not ‘coated’ with Hp1a by imaging. Might be an antibody accessability thing.  Should compare with bio-labeled centromere probe.  I remember when I last … Continue reading →

Posted in Summaries | Tagged , , | Comments Off on Wednesday 12/12/12