February 2025 M T W T F S S « Aug 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 Categories
- AP patterning (13)
- Blog (1)
- Chromatin (88)
- Conference Notes (72)
- Fly Work (54)
- General STORM (25)
- Genomics (134)
- Journal Club (22)
- Lab Meeting (66)
- Microscopy (79)
- Notes (1)
- probe and plasmid building (58)
- Project Meeting (3)
- Protocols (13)
- Research Planning (74)
- Seminars (21)
- Shadow Enhancers (59)
- snail patterning (40)
- Software Development (5)
- Summaries (1,412)
- Teaching (9)
- Transcription Modeling (40)
- Uncategorized (10)
- Web development (19)
Links
Tags
analysis cell culture cell labeling chromatin cloning coding communication confocal data analysis embryo collection embryo labeling figures fly work genomics hb image analysis image processing images in situs Library2 literature making antibodies matlab-storm meetings modeling MP12 mRNA counting Ph planning presentation probe making project 2 project2 result results sectioning section staining shadow enhancers sna snail staining STORM STORM analysis troubleshooting writing-
GitHub Projects
Tag Archives: literature
Friday 05/16/14
Chromatin Project Analyzing E06+ E07 data: chr2R:19726615-19888410__YELLOW_D12 a + b 4Tb hard-drive in Kangaroo mount died. All data from F03-F02 and F04-F02 lost. Drive recovery services probably not worth it. Damn it. chkdsk ‘recovered’ the files by deleting all the … Continue reading
Tuesday 02/04/2014
11:00a – 8:00p, 9:30p – 10:30p Ph project Manuscript writing working on model section finished description of first model (on-rate or off-rate limited) finished writing description of second model, ~3:30p, (chromatin availability limited) working on methods section wrote description of … Continue reading
Friday 01/31/14
10:50a – 11:50p Goals Today Order primers for sequencing work on Ph manuscript finish hybes to test sample age image F03F04 samples Deep sequencing 2 probes to order with sequencing indices D12 (375kb) GTGTCGCGTCGGCCAGAAAC F11 (180kb) AGGACATTCGCGGCTTTCAG G09 (76kb) CGTCGCGTTGGATTCAAGAG … Continue reading
Monday 12/30/13
9:20a -7:00p Goals Analyze 2-color STORM data test out new image-writers for hal Getting started Monet windows explorer froze and got killed. Requires restart. Finish up notes from yesterday, add gel images to notebook. STORM attempted software update to do … Continue reading
Sunday 12/29/13
9:00a – 12:15a Goals Write to Ajaz about new plans Read in _oligo.txt files and analyze probe distributions STORM G1-G2 Start analysis of F12-G01 and F12-G11 data continue work on STORMrender Manual Literature Reading Kieffer-Kwon et al Cell 2013. link … Continue reading
Posted in Summaries
Tagged coding, images, literature, probe making, STORM
Comments Off on Sunday 12/29/13
Thursday 07/11/13
10:00 A – 7:00P, 8:30P-10:00P STORM Finish O/N run of PhM-flag-488, Ph-647 take bead images transfer data to ProRAID Set up analysis to run on Cajal Embryo in situs wash out probes check staining: All embryos washed off! 1 tiny … Continue reading
Wednesday 05/08/13
9:30 A — Probe making pool digests aliquot out test DNA: 1 uL digest DNA, 3 uL TBE, 1 uL 6x loading dye + 12x gel green, 5 uL formamide with 5% 5M EDTA Pour new 16% urea PAGE gels … Continue reading
Posted in Summaries
Tagged literature, probe making, STORM, STORM analysis
Comments Off on Wednesday 05/08/13
Tuesday 05/07/13
9:25 A -5:50 P Ph FLAG Processing confocal images of Ph data updated ImageShop / ExtractLSM to fix bug in multi-position loader. Ph FLAG discussion / comments: post Literature Pirrotta Insulators target active genes to transcription factories and polycomb-repressed genes … Continue reading
Monday 01/07/13
9:30 A – 8:30P, Probe making Emulsion PCR of engrailed region probe at Wu lab. Final library concentration 16 ng/uL, in 14 uL. Should PCR amplify once. Brian will run test PCR and test gel to check library quality … Continue reading
Wednesday 12/12/12
10:30 A – 7:30P, Data analysis Analyzing Hp1a centromere data Labeling density still somewhat low, centromere certainly not ‘coated’ with Hp1a by imaging. Might be an antibody accessability thing. Should compare with bio-labeled centromere probe. I remember when I last … Continue reading
Posted in Summaries
Tagged data analysis, literature, presentation
Comments Off on Wednesday 12/12/12