Category Archives: Summaries

Daily work summaries

Checking out 08/26/16

Last day! It’s my last day in the Zhuang lab and this my last notebook post. For the last 6 months, I’ve predominantly shifted to using an IPython based notebook hosted on the ZhuangLab github website (https://github.com/ZhuangLab/python-scripts). Bogdan and I … Continue reading

Posted in Summaries | Comments Off on Checking out 08/26/16

Protected: lab meeting 03/25/15

There is no excerpt because this is a protected post.

Posted in Lab Meeting, Summaries | Comments Off on Protected: lab meeting 03/25/15

Thursday, 03/24/16

9:00 am – 8:40 pm Fluid control challenges fluid control system from STORM1 need drivers for the usb-to-serial connection to the peristaltic pump switching to a new usb-to-serial hub didn’t work (windows recognizes, kilroy fails communication) eventually found, downloaded and … Continue reading

Posted in Summaries | Comments Off on Thursday, 03/24/16

Wednesday 03/23/16

9:00 am – 7:30 pm, 8:45 pm – 12:00 am Sectioning observations mounting sample in the sharp-nosed conic capsules is actually excellent for ultra-cryo mount (should order more of these) Testing L8 12:00 pm, incubating L7 and L8 on recently … Continue reading

Posted in Summaries | Comments Off on Wednesday 03/23/16

Tuesday 03/22/16

9:00 am – 5:00 pm Ultra-sectioning Fill LN2 (upstairs dewar is empty need to go downstairs to fill) Poly-lysine coat newly cleaned 50 mm coverslips — dipped in pure poly-D lysine solution substantial residue after air drying. The adhered samples … Continue reading

Posted in Summaries | Comments Off on Tuesday 03/22/16

Monday 03/21/16

10:00 am – 6:30 pm Tasks see private post from today for to dos. Experiments rehydrated embryos embedded in 12% gelatin incubating step-wise into 70% sucrose for freezing scheduled cryo-ultratome for tomorrow. Microscope setup spec’ing and ordering parts — see … Continue reading

Posted in Summaries | Comments Off on Monday 03/21/16

Tuesday 03/09/16

9:45 am – 7:15 pm Probe synthesis Set up RT reactions ran RT reactions ran gel ran oligo cleanup see updated protocol Gel results: (Lib7-10 kb BX-C, Lib7-2kb BX-C, Lib8-15 kb en), DNA left, Cy3 right (with gel green blead-through). … Continue reading

Posted in Summaries | Comments Off on Tuesday 03/09/16

Monday, 03/08/16

10:00 am – 6:00 pm, New Library synthesis chr-L8 (en-locus) T7 L6E3_R primer_232 TAATACGACTCACTATAGGG TTGCGCGAGACCAACGTACG L6E1_F primer_226 CCGTACGTCGAGTCGGGTCG Was: T7 L6E2_R primer_230 TAATACGACTCACTATAGGG TGATCATCGCTCGCGGGTTG, swapped out for L6E3_R to avoid cross-talk with DSB-lib Also doing L7 10 kb and 2 … Continue reading

Posted in Summaries | Comments Off on Monday, 03/08/16

About my notebook This is my lab notebook.  It is how I organize and document my scientific research on a day-to-day basis.  It is intended primarily for my personal use as a permenant record of my work. Unlike traditional notebooks, … Continue reading

Posted on by admin | Leave a comment

Protected: Friday 02/26/16

There is no excerpt because this is a protected post.

Posted in Summaries | Comments Off on Protected: Friday 02/26/16