November 2025 M T W T F S S « Aug 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 Categories
- AP patterning (13)
- Blog (1)
- Chromatin (88)
- Conference Notes (72)
- Fly Work (54)
- General STORM (25)
- Genomics (134)
- Journal Club (22)
- Lab Meeting (66)
- Microscopy (79)
- Notes (1)
- probe and plasmid building (58)
- Project Meeting (3)
- Protocols (13)
- Research Planning (74)
- Seminars (21)
- Shadow Enhancers (59)
- snail patterning (40)
- Software Development (5)
- Summaries (1,412)
- Teaching (9)
- Transcription Modeling (40)
- Uncategorized (10)
- Web development (19)
Links
Tags
analysis cell culture cell labeling chromatin cloning coding communication confocal data analysis embryo collection embryo labeling figures fly work genomics hb image analysis image processing images in situs Library2 literature making antibodies matlab-storm meetings modeling MP12 mRNA counting Ph planning presentation probe making project 2 project2 result results sectioning section staining shadow enhancers sna snail staining STORM STORM analysis troubleshooting writing-
GitHub Projects
Author Archives: admin
Monday, 03/08/16
10:00 am – 6:00 pm, New Library synthesis chr-L8 (en-locus) T7 L6E3_R primer_232 TAATACGACTCACTATAGGG TTGCGCGAGACCAACGTACG L6E1_F primer_226 CCGTACGTCGAGTCGGGTCG Was: T7 L6E2_R primer_230 TAATACGACTCACTATAGGG TGATCATCGCTCGCGGGTTG, swapped out for L6E3_R to avoid cross-talk with DSB-lib Also doing L7 10 kb and 2 … Continue reading
Posted in Summaries
Comments Off on Monday, 03/08/16
About my notebook This is my lab notebook. It is how I organize and document my scientific research on a day-to-day basis. It is intended primarily for my personal use as a permenant record of my work. Unlike traditional notebooks, … Continue reading
Protected: Friday 02/26/16
There is no excerpt because this is a protected post.
Posted in Summaries
Comments Off on Protected: Friday 02/26/16
Protected: Alex Pollen — human vs chimp brain organization
There is no excerpt because this is a protected post.
Posted in Seminars
Comments Off on Protected: Alex Pollen — human vs chimp brain organization
Thursday, 2/25/16
Seminars Alex Pollen seminar (see notes) Microscope building HHMI equipment cycle equipment granted was 3 MPB lasers (560, 647, 750), Hamamatsu camera, Nikon microscope body w/ 8K of extras, Coherent 488 laser submitted separate quote addressed to Harvard for optics … Continue reading
Posted in Summaries
Comments Off on Thursday, 2/25/16
Protected: Monday 02/22/16
There is no excerpt because this is a protected post.
Posted in Summaries
Comments Off on Protected: Monday 02/22/16
Friday 02/19/16
9:00 am – 5:00 pm Tasks lab meeting 10 am – 12:30 pm (see notes) FISH with Hazen — prepped cells up to hyb step, should be in formamide by tonight Reply to request from Biteen lab for code help … Continue reading
Posted in Summaries
Comments Off on Friday 02/19/16
Protected: lab meeting 02/19/16
There is no excerpt because this is a protected post.
Posted in Lab Meeting
Comments Off on Protected: lab meeting 02/19/16
Protected: thoughts on improving my chalk talk
There is no excerpt because this is a protected post.
Posted in Research Planning
Comments Off on Protected: thoughts on improving my chalk talk
Thursday 09/18/16
9:30 am – 9:00 pm Tasks reply to MIT IMES / Physics reply to Caltech submit patent signatures Discussion with Hsuan – microscopes and plans Discussion with BB using common label as a fiducial for XYZ corrections validate if I … Continue reading
Posted in Summaries
Comments Off on Thursday 09/18/16