Author Archives: admin

Monday, 03/08/16

Posted on March 7, 2016 by admin

10:00 am – 6:00 pm, New Library synthesis chr-L8 (en-locus) T7 L6E3_R primer_232 TAATACGACTCACTATAGGG TTGCGCGAGACCAACGTACG L6E1_F primer_226 CCGTACGTCGAGTCGGGTCG Was: T7 L6E2_R primer_230 TAATACGACTCACTATAGGG TGATCATCGCTCGCGGGTTG, swapped out for L6E3_R to avoid cross-talk with DSB-lib Also doing L7 10 kb and 2 … Continue reading →

Posted in Summaries | Comments Off on Monday, 03/08/16

About my notebook This is my lab notebook.  It is how I organize and document my scientific research on a day-to-day basis.  It is intended primarily for my personal use as a permenant record of my work. Unlike traditional notebooks, … Continue reading →

Posted on February 27, 2016 by admin | Leave a comment

Protected: Friday 02/26/16

Posted on February 26, 2016 by admin

There is no excerpt because this is a protected post.

Posted in Summaries | Comments Off on Protected: Friday 02/26/16

Protected: Alex Pollen — human vs chimp brain organization

Posted on February 25, 2016 by admin

There is no excerpt because this is a protected post.

Posted in Seminars | Comments Off on Protected: Alex Pollen — human vs chimp brain organization

Thursday, 2/25/16

Posted on February 25, 2016 by admin

Seminars Alex Pollen seminar (see notes) Microscope building HHMI equipment cycle equipment granted was 3 MPB lasers (560, 647, 750), Hamamatsu camera, Nikon microscope body w/ 8K of extras, Coherent 488 laser submitted separate quote addressed to Harvard for optics … Continue reading →

Posted in Summaries | Comments Off on Thursday, 2/25/16

Protected: Monday 02/22/16

Posted on February 22, 2016 by admin

There is no excerpt because this is a protected post.

Posted in Summaries | Comments Off on Protected: Monday 02/22/16

Friday 02/19/16

Posted on February 19, 2016 by admin

9:00 am – 5:00 pm Tasks lab meeting 10 am – 12:30 pm (see notes) FISH with Hazen — prepped cells up to hyb step, should be in formamide by tonight Reply to request from Biteen lab for code help … Continue reading →

Posted in Summaries | Comments Off on Friday 02/19/16

Protected: lab meeting 02/19/16

Posted on February 19, 2016 by admin

There is no excerpt because this is a protected post.

Posted in Lab Meeting | Comments Off on Protected: lab meeting 02/19/16

Protected: thoughts on improving my chalk talk

Posted on February 18, 2016 by admin

There is no excerpt because this is a protected post.

Posted in Research Planning | Comments Off on Protected: thoughts on improving my chalk talk

Thursday 09/18/16

Posted on February 18, 2016 by admin

9:30 am – 9:00 pm Tasks reply to MIT IMES / Physics reply to Caltech submit patent signatures Discussion with Hsuan – microscopes and plans Discussion with BB using common label as a fiducial for XYZ corrections validate if I … Continue reading →

Posted in Summaries | Comments Off on Thursday 09/18/16