Author Archives: admin

Tamara Broderick: Stats Seminar, Feature allocation

Posted on February 3, 2014 by admin

Feature allocation, probability functions, and paintboxes Intro unsupervised learning canonical example, clustering what if objects are a part of multiple groups? feature allocation each group is now called a feature not a cluster Assumptions exchangeable finite number of features per … Continue reading →

Posted in Seminars | Comments Off on Tamara Broderick: Stats Seminar, Feature allocation

Protected: Hao practice talk

Posted on February 3, 2014 by admin

There is no excerpt because this is a protected post.

Posted in Project Meeting | Comments Off on Protected: Hao practice talk

Sunday 02/02/14

Posted on February 2, 2014 by admin

10:00a – 7:30p, 9:50p – 1:40a Literature need an article for journal club in 2 weeks. Elife article on transcription imaging from Tijan lab. Feng Zhang lab optical control of transcription. Optical control of transcription. Nature, this was published 7 … Continue reading →

Posted in Summaries | Tagged , , | Comments Off on Sunday 02/02/14

Journal club 12/16/13: Light activated K channel

Posted on February 2, 2014 by admin

Journal club presented by Guisheng In Vivo Expression of a Light-Activatable Potassium Channel Using Unnatural Amino Acids using un-nautral ammino acids to make irreversibly inducible potassium ion channels. not clear how this is really an improvement or has advantages over … Continue reading →

Posted in Journal Club | Comments Off on Journal club 12/16/13: Light activated K channel

Saturday 02/01/14

Posted on February 1, 2014 by admin

6:30p Goals break down STORM4 run DONE Modify STORMrender savedata to save in color images, matching display (currently doing bw) also ensure axis square (axis image); Mentoring helping Guipeng realign STORM4 for new fast camera

Posted in Summaries | Comments Off on Saturday 02/01/14

Friday 01/31/14

Posted on January 31, 2014 by admin

10:50a – 11:50p Goals Today Order primers for sequencing work on Ph manuscript finish hybes to test sample age image F03F04 samples Deep sequencing 2 probes to order with sequencing indices D12 (375kb) GTGTCGCGTCGGCCAGAAAC F11 (180kb) AGGACATTCGCGGCTTTCAG G09 (76kb) CGTCGCGTTGGATTCAAGAG … Continue reading →

Posted in Summaries | Tagged , , , | Comments Off on Friday 01/31/14

Thursday 01/30/14

Posted on January 30, 2014 by admin

9:55a – 10:00p Chromatin Project cell fixing and staining fix new Kc cells prep for in situ treat with RNase stain new kc cells with F03F04 and G01G02 Ph Data analysis wt data has half the number of frames (54,000 … Continue reading →

Posted in Summaries | Tagged , | Comments Off on Thursday 01/30/14

Wednesday 01/29/14

Posted on January 29, 2014 by admin

9:10a – 8:00p, 9:50p – 2:30a Ph project revising manuscript draft working on abstract refocusing discussion of PcG clusters. Need to distinguish between the sparse micron-scale PcG bodies other people have studied and the numerous, nano-scale bodies we focus on. … Continue reading →

Posted in Summaries | Tagged , , | Comments Off on Wednesday 01/29/14

Tuesday 01/28/14

Posted on January 28, 2014 by admin

9:15a – 10:50a, 12:00p – 10:15p Chromatin Project Chromatin Analysis Data Analysis Continued analyzing D12 data from 10-26-13 up through image 26 (still plenty more dots to image). F06 analyzed up to but not including image 0_2. Developing analysis pipeline … Continue reading →

Posted in Summaries | Tagged , | Comments Off on Tuesday 01/28/14

Protected: chromatin analysis in progress

Posted on January 28, 2014 by admin

There is no excerpt because this is a protected post.

Posted in Chromatin | Tagged , | Comments Off on Protected: chromatin analysis in progress