Categories
- AP patterning (13)
- Blog (1)
- Chromatin (88)
- Conference Notes (72)
- Fly Work (54)
- General STORM (25)
- Genomics (134)
- Journal Club (22)
- Lab Meeting (66)
- Microscopy (79)
- Notes (1)
- probe and plasmid building (58)
- Project Meeting (3)
- Protocols (13)
- Research Planning (74)
- Seminars (21)
- Shadow Enhancers (59)
- snail patterning (40)
- Software Development (5)
- Summaries (1,412)
- Teaching (9)
- Transcription Modeling (40)
- Uncategorized (10)
- Web development (19)
Links
Tags
analysis cell culture cell labeling chromatin cloning coding communication confocal data analysis embryo collection embryo labeling figures fly work genomics hb image analysis image processing images in situs Library2 literature making antibodies matlab-storm meetings modeling MP12 mRNA counting Ph planning presentation probe making project 2 project2 result results sectioning section staining shadow enhancers sna snail staining STORM STORM analysis troubleshooting writing-
GitHub Projects
Daily Archives: January 31, 2014
Friday 01/31/14
10:50a – 11:50p Goals Today Order primers for sequencing work on Ph manuscript finish hybes to test sample age image F03F04 samples Deep sequencing 2 probes to order with sequencing indices D12 (375kb) GTGTCGCGTCGGCCAGAAAC F11 (180kb) AGGACATTCGCGGCTTTCAG G09 (76kb) CGTCGCGTTGGATTCAAGAG … Continue reading