Categories
- AP patterning (13)
- Blog (1)
- Chromatin (88)
- Conference Notes (72)
- Fly Work (54)
- General STORM (25)
- Genomics (134)
- Journal Club (22)
- Lab Meeting (66)
- Microscopy (79)
- Notes (1)
- probe and plasmid building (58)
- Project Meeting (3)
- Protocols (13)
- Research Planning (74)
- Seminars (21)
- Shadow Enhancers (59)
- snail patterning (40)
- Software Development (5)
- Summaries (1,412)
- Teaching (9)
- Transcription Modeling (40)
- Uncategorized (10)
- Web development (19)
Links
Tags
analysis cell culture cell labeling chromatin cloning coding communication confocal data analysis embryo collection embryo labeling figures fly work genomics hb image analysis image processing images in situs Library2 literature making antibodies matlab-storm meetings modeling MP12 mRNA counting Ph planning presentation probe making project 2 project2 result results sectioning section staining shadow enhancers sna snail staining STORM STORM analysis troubleshooting writing-
GitHub Projects
Monthly Archives: March 2016
Protected: lab meeting 03/25/15
There is no excerpt because this is a protected post.
Posted in Lab Meeting, Summaries
Comments Off on Protected: lab meeting 03/25/15
Thursday, 03/24/16
9:00 am – 8:40 pm Fluid control challenges fluid control system from STORM1 need drivers for the usb-to-serial connection to the peristaltic pump switching to a new usb-to-serial hub didn’t work (windows recognizes, kilroy fails communication) eventually found, downloaded and … Continue reading
Posted in Summaries
Comments Off on Thursday, 03/24/16
Wednesday 03/23/16
9:00 am – 7:30 pm, 8:45 pm – 12:00 am Sectioning observations mounting sample in the sharp-nosed conic capsules is actually excellent for ultra-cryo mount (should order more of these) Testing L8 12:00 pm, incubating L7 and L8 on recently … Continue reading
Posted in Summaries
Comments Off on Wednesday 03/23/16
Tuesday 03/22/16
9:00 am – 5:00 pm Ultra-sectioning Fill LN2 (upstairs dewar is empty need to go downstairs to fill) Poly-lysine coat newly cleaned 50 mm coverslips — dipped in pure poly-D lysine solution substantial residue after air drying. The adhered samples … Continue reading
Posted in Summaries
Comments Off on Tuesday 03/22/16
Monday 03/21/16
10:00 am – 6:30 pm Tasks see private post from today for to dos. Experiments rehydrated embryos embedded in 12% gelatin incubating step-wise into 70% sucrose for freezing scheduled cryo-ultratome for tomorrow. Microscope setup spec’ing and ordering parts — see … Continue reading
Posted in Summaries
Comments Off on Monday 03/21/16
Protected: Caltech Symposium 03/18/16
There is no excerpt because this is a protected post.
Posted in Conference Notes
Comments Off on Protected: Caltech Symposium 03/18/16
Tuesday 03/09/16
9:45 am – 7:15 pm Probe synthesis Set up RT reactions ran RT reactions ran gel ran oligo cleanup see updated protocol Gel results: (Lib7-10 kb BX-C, Lib7-2kb BX-C, Lib8-15 kb en), DNA left, Cy3 right (with gel green blead-through). … Continue reading
Posted in Summaries
Comments Off on Tuesday 03/09/16
Monday, 03/08/16
10:00 am – 6:00 pm, New Library synthesis chr-L8 (en-locus) T7 L6E3_R primer_232 TAATACGACTCACTATAGGG TTGCGCGAGACCAACGTACG L6E1_F primer_226 CCGTACGTCGAGTCGGGTCG Was: T7 L6E2_R primer_230 TAATACGACTCACTATAGGG TGATCATCGCTCGCGGGTTG, swapped out for L6E3_R to avoid cross-talk with DSB-lib Also doing L7 10 kb and 2 … Continue reading
Posted in Summaries
Comments Off on Monday, 03/08/16