Alistair's Lab Notebook

9:15 am – 5:00 pm

Tasks

• collect and match primers for DSB library
• training GN on AO STORM3
  • Boran helped review protocol: MicAO software (not AO folder)
  • use hal to select record and save frames and then use AO software to Play from the target folder to read in frames and compute mode optimization

9:30 am – 7:00 pm

Our work, “Super-resolution imaging reveals distinct folding for different epigenetic states” is now out in Nature!

Our work, “Chromatin topology is coupled to Polycomb Group protein subnuclear organization” is now out in Nature Communications

Tasks

• lab cleaning — clean cold-room.
• catching up on emails after interview-visit.
• had some broken links on software page, updated these.
• Sorting out reimbursement paperwork for EMBO conference (Lisa is contact)
• order primers
  • T7 = ‘TAATACGACTCACTATAGGG’;
  • L7_FwdCommon: ACCTCCGTTAGACCCGTCAGGATAGGCCCT
  • L7_Rev1, BX-C steven-probes, 10kb pieces: seqrcomplement(‘CCTTCCGACGGTCTAACCGA’) TAATACGACTCACTATAGGG TCGGTTAGACCGTCGGAAGG
  • L7_Rev2, BX-C steven-probes, 2kb pieces: seqrcomplement(‘AGGCCGGGCGCGGTATGGTT’) TAATACGACTCACTATAGGG AACCATACCGCGCCCGGCCT
  • L7_Rev3, BX-C fast probes, 10kb pieces seqrcomplement(‘GGGAGGTACGCTCATGTGCT’) TAATACGACTCACTATAGGG AGCACATGAGCGTACCTCCC
  • also designed toe probes and ready to order (waiting for O-card to recharge first though).
• catching up on literature.

9:30 am – 8:30 pm

to do

• edit page-proofs for PcG clustering paper
• literature review
• travel reimbursement paperwork for last interview
• new library designs (started)
• flip fly stocks (not done)
• discussion with XZ on collaborations

Literature

• Prescott and Wysocka paper on cis-reg evolution in human vs. Chimp
• rereading Zabidi and Stark paper on enhancer-promoter specificity

Coding

• design new library for project with BB
• design new library for project with HB

10:30 am – 7:00 pm

Tasks

• formatting figures for Ph Polymerization paper.
• sent final version of figures to team.
• discussion with XZ about proposal.
• Phone interview (3pm -3:30pm)
• discuss model fitting with GF, reply to team with conclusions.

Recently complete

• flipped fly stocks yesterday
• sent abstract to Cornell

Still to do

• formatting of supp figures
  • adjust page sizes
  • make sure headings are uniform
  • combine into single PDF with text portion

Scheduling

• practice talk Friday morning (10 am)
• practice chalk talk Mon evening (5 pm)
• need to revise research proposal and send to XZ

10:00 am

Tasks

Manuscript

• Revise response to reviewer 1
• Figure updates
  • change blue color
  • fix symbols
• discussed changes with XZ again

Fastq files

• run 1: 150902_NS500422_0189_AHHNKFBGXX Illumina HiSeq 2500, 100 bp single read, rapid flowcell
• run 2: 151030_SN343_0533_AC8CW1ACXX Illumina HiSeq 2000, 50 bp single read, standard cell

Run 1 checksums

5_S5.R1.fastq.gz 35edcf8de86c0121ed0299e3026c3996
3_S3.R1.fastq.gz 225a5a5c2318e07deb044fd2bb5f5d06
2_S2.R1.fastq.gz 07203cda1dde852c01c3eb1014e97574
6_S6.R1.fastq.gz d07b0b67730adf45d5e3abf9926bf2d1
1_S1.R1.fastq.gz 6a61879b157d3710e4e81c07ef81c920
4_S4.R1.fastq.gz 63cdc9bc347d26f43e2d0e72fba469c5

windows checksum doesn’t give a checksum report, it just runs for a while and then stops.

Identified issues with Fastq files

• some reads have no read data
• writing script to remove reads (all 4 lines) which have no sequences (just an index primer).

More failed programs

• Odyssey claims to have a fastqc installed but it doesn’t run.
  • https://portal.rc.fas.harvard.edu/apps/modules
  • typing exactly module load fastqc/0.11.3-fasrc01 gives an error.
• tried virtualbox. Can’t access local files. This is stupid unfortunate.
• tried bioawk. Installed on linux virtualbox. can’t get on Odyssey. Can’t access local files to run.
• tried fastqValidate. Can’t install on windows. install fails on linux virtualbox.
• removing blanks by hand with custom matlab script
• accidently added spaces in printing new fastq files. Fixed this.
• fixed files do run in bowtie, but it still complains about a bunch of reads having insufficient length
• wrote new matlab file to cut on read lengths less than 20
  • had some errors with this script.
  • fixed issue with not checking read lines (was checking all lines, then was checking only 1st line, not read line).
• lots of issues with disk copy speed.
• was cutting at 20 bp reads, I think this might cut too much — not resemble data. Dropped to cutting at 10 bp reads.

12:30 pm – 11:30 pm

(HHS appointment in morning for crushed foot).

Making RNA probes through old method as a control for RNA staining quality

• found sna and hb probe templates
• hb tube is empty, attempted to dissolve DNA from evaporated sample with added H2O (10 uL).
• ran PCR reactions with m13F + m13R primers using Phusion
• 30 cycles (reset annealing temp?)
• run test gel (0.7% in TAE with gene ruler express)
• sna amplified, hb didn’t. Probably ran a bit too many cycles / not enough primer: some snail concatamers. Shouldn’t really cause problems.
  

in vitro transcription reaction (old style as control)

• following old protocol
• Per 20 uL reaction
  • 4 uL 5x buffer
  • 2 uL 10x dig-mix
  • 1 uL T7
  • 1 uL RNasin
  • 1 uL DTT
  • 5 uL DNA template
  • 6 uL ddH2O
• Run as a 40 uL reaction
  • 8 uL 5x buffer
  • 5 uL 10x dig-mix (expired)
  • 3 uL T7 (expired)
  • 2 uL RNAsin
  • 2 uL DTT
  • 10 uL DNA template
  • 10 uL ddH2O
• ran carb treatment, STOP treatment, and percipitate with LiCl overnight at -20C.

Manuscript edits

• discuss shortening with XZ
• revise text to shorten
• update calculator
• revise figures