Monthly Archives: January 2014

Friday 01/31/14

Posted on January 31, 2014 by admin

10:50a – 11:50p Goals Today Order primers for sequencing work on Ph manuscript finish hybes to test sample age image F03F04 samples Deep sequencing 2 probes to order with sequencing indices D12 (375kb) GTGTCGCGTCGGCCAGAAAC F11 (180kb) AGGACATTCGCGGCTTTCAG G09 (76kb) CGTCGCGTTGGATTCAAGAG … Continue reading →

Posted in Summaries | Tagged , , , | Comments Off on Friday 01/31/14

Thursday 01/30/14

Posted on January 30, 2014 by admin

9:55a – 10:00p Chromatin Project cell fixing and staining fix new Kc cells prep for in situ treat with RNase stain new kc cells with F03F04 and G01G02 Ph Data analysis wt data has half the number of frames (54,000 … Continue reading →

Posted in Summaries | Tagged , | Comments Off on Thursday 01/30/14

Wednesday 01/29/14

Posted on January 29, 2014 by admin

9:10a – 8:00p, 9:50p – 2:30a Ph project revising manuscript draft working on abstract refocusing discussion of PcG clusters. Need to distinguish between the sparse micron-scale PcG bodies other people have studied and the numerous, nano-scale bodies we focus on. … Continue reading →

Posted in Summaries | Tagged , , | Comments Off on Wednesday 01/29/14

Tuesday 01/28/14

Posted on January 28, 2014 by admin

9:15a – 10:50a, 12:00p – 10:15p Chromatin Project Chromatin Analysis Data Analysis Continued analyzing D12 data from 10-26-13 up through image 26 (still plenty more dots to image). F06 analyzed up to but not including image 0_2. Developing analysis pipeline … Continue reading →

Posted in Summaries | Tagged , | Comments Off on Tuesday 01/28/14

Protected: chromatin analysis in progress

Posted on January 28, 2014 by admin

There is no excerpt because this is a protected post.

Posted in Chromatin | Tagged , | Comments Off on Protected: chromatin analysis in progress

Monday 01/27/14

Posted on January 27, 2014 by admin

9:45a – 11:55p Meetings Group meeting, Jeff presents (see protected notes) Journal club (see notes) Meeting with Ajaz, get antibody Meeting with Brian B, discuss figure put chromatin loop image last as speculative difference for main figure, combine replicates in … Continue reading →

Posted in Summaries | Comments Off on Monday 01/27/14

Journal Club 01/27/14

Posted on January 27, 2014 by admin

Doory Ultrafast endocytosis at mouse hippocampal synapses Nature 504, 2013 Background lab previously published correlative EM Combine optogentics and high-pressure freezing ‘flash and freeze’, to study synapse. 40 nm EM sections methods of exocytosis full fusion (vesicle fuses and releases) … Continue reading →

Posted in Journal Club | Comments Off on Journal Club 01/27/14

Protected: group meeting 01/27/14

Posted on January 27, 2014 by admin

There is no excerpt because this is a protected post.

Posted in Lab Meeting | Tagged | Comments Off on Protected: group meeting 01/27/14

Sunday 01/26/14

Posted on January 26, 2014 by admin

10:20a – 10:00p Literature reading Polycomb Potentiates Meis2 Activation in Midbrain by Mediating Interaction of the Promoter with a Tissue-Specific Enhancer read Cavalli’s summary Ring1 activator and repressor. Article makes it sound to me like Ring1 is an activator. Just … Continue reading →

Posted in Summaries | Tagged , , | Comments Off on Sunday 01/26/14

Saturday 01/25/13

Posted on January 25, 2014 by admin

10:30a – 5:30p, 7:00p – 8:00p remotey 9:30p – 11:45p Chromatin Project Data analysis / code development: ChromatinCropper Integrating 3D images working on 3D image masks. Fixed up Stats2DScatter currently hard-coded in z-range is -300 300 corrected x4. Our calibration … Continue reading →

Posted in Summaries | Comments Off on Saturday 01/25/13