Tuesday 11/13/12

9:15 A – 6:50P, 8:00-9:30P

  • STORM analysis 750 still running, min height probably too low.  Raised defaults for next time.
Prep for genotype screening
  • Order primers for testing MP10 MP05 differences (seems like labeled MP10 lacks expression).
  • DNA extraction using DNAzol: not able to spool DNA efficiently.  PLoSONE paper Protocol recommends 2 hrs of lysis prior to ethanol addition.  More ethanol slightly better yield?
  • I just pelleted all the extract in ethanol. Washed with 70% ethanol, resuspend in dH2O and see if it works for sequencing.
  • PCR reactions: Genomic DNA from YW, simD, Espl, each with AbdB1-F/R, simD-F/R = 6 rxns.  Test on gel tomorrow

 

Embryo labeling

  • in situs Day 2
  • DFISH in situs Day 2.  Fab7-488 probe from Fred works great based on first images on confocal from initial post-hybe wash.
  • change labeling scheme for in situs?:  Dm0-488 (conventional only, get nuclei outline for clusters-per-nucleus analysis etc.)  Cy3B with low power STORM for locus #1.  A647 for protein (H3K27me3 or PcGs).  IR800 for locus #2?  Get rid of H3-label (nice images but long time to fit and not being used very much).

 

Fly work

  • Flies emerging from recombination crosses (hopefully we can figure out the boundaries of the Espl deletion so that the PCR screening becomes possible for recombinants).
  • Ordered long taq which should help this attempt.
  • Collect virgins for recombination cross

 

Oligiopaint probe design final step:

  • cd C:\Python27
  • python  C:\Users\Alistair\Documents\Projects\Chromatin\Code\OligoPaints\scripts\orderFile.py -i  D:\Data\Genome_TRACKS\OligoPaintProbes\BLUE_chr2R_7350000_to_7470000.bed
  • F: TCCTAAATCCTAGCCCATACGGCAATG R: GGACATGGGTCAGGTAGGTTG
  • python  C:\Users\Alistair\Documents\Projects\Chromatin\Code\OligoPaints\scripts\orderFile.py -i  D:\Data\Genome_TRACKS\OligoPaintProbes\BLACK_chr2R_15725000_to_15837000.bed
  • F: GAGCAGTCACAGTCCAGAAGGGCAATG R: GTATCGTGCAAGGGTGAATGC
  • python  C:\Users\Alistair\Documents\Projects\Chromatin\Code\OligoPaints\scripts\orderFile.py -i  D:\Data\Genome_TRACKS\OligoPaintProbes\GREEN_chr2R_400000_to_512000.bed
  •  F: GAGTTTGAGGCTGTGTGCTTGGCAATG R: CATAGAACGGAAGAGCGTGTG
  • python  C:\Users\Alistair\Documents\Projects\Chromatin\Code\OligoPaints\scripts\orderFile.py -i  D:\Data\Genome_TRACKS\OligoPaintProbes\YELLOW_chr2R_3328000_to_3430000.bed
  •  F: GGGAGTAGGGTCCTTTGTGTGGCAATG R: TTGATCTCGCTGGATCGTTCT
  • Still don’t have KaqTaq for probe synthesis.

 

 

 

This entry was posted in Summaries. Bookmark the permalink.