9:00a – 12:20a
Goals
- work on data analysis / slides for meeting with Ting tomorrow
- new round of yellow chromatin RNA DNA double stains. Include attempt restain E10rna. Still needs RNase.
- 3D z-calibration [POSTPONED]
- Start statistical analysis of Blue Polymer simulations [POSTPONED]
- Work on figures for Ph project [POSTPONED]
Chromatin Colors
Cell Staining
- stained new RNA: D12 E08, E10
- RNase treated E10rna sample.
- new DNA stain for E10rna cells, attempt sequential imaging tomorrow.
STORM Imaging
- Finish O/N STORM run of F08 on STORM2
- Transfer data from STORM2 to Monet
Polymer Simulations
- All simulations on Odyssey O/N ended in NODE-FAIL
Data Analysis
F11 (ANTC left, 180 kb) Observations
- Highly variable
G10
- Generally very large. Could use more spots.
F09 Observations:
- F09 dots are way too big.
- possible cross contamination?
follow up on cross-talk in F09
- Check cross contamination using M matrix. Looks pretty substantial (see above)
- But previous analysis suggests most of these contaminates are not (nearly) full length.
- Working on new pipeline to look at purity.
- Looking at off target sequences that have 25 bp of sequence.
- G02 and F09 have 3′ primer overlap! Need to screen this out! how was this missed by BLAST?
‘F09’ [ 216] ‘TCCGCCGTGTTATCGATTTG’
‘G02’ [1046] ‘ATTCAACGGCCCTCGATTTG’
Some dots look much more G2 like. Others maybe more
Basic Data Processing
- Ran chromatic analysis for 13-11-24_D10 beads. Substantial offset (25+ pixels!) needed to register colors
- Reran / troubleshot chromatic analysis for 13-11-01_F07 Beads
- Ran chromatic analysis for 13-11-25_D08 beads.
Coding
- Could use more robust matchmols function. When multiple molecules are within the match radius, chose the nearest.
Computer Stuff
- Install updates and Reboot Tuck / Cajal
- Install new 16Gb RAM (on Tuck?)
- Tuck fails to boot with new ram. Despite the fact all modules are PC3-10600 4Gb DDR3 1333 MHz.
- Ram is incompatible — needs to be ECC Registered ram.
- Forgot to put fan cover back on Tuck before reboot. Will need to do this.
- Install Matlab 2013b on Tuck, Cajal and Monet (requires all active versions of Matlab to be shut down).
- downloaded 2013b directly from FAS website (download from mathworks site not enabled any more under current license).
- OligoArrayAux / OligoArray2.1 now running on Tuck
Odyssey computing
- all queue_Blue tasks ended with NODE_FAIL errors.
- wrote to RC about repeated issues.