Monday 12/02/13

9:00a – 12:20a

Goals

  • work on data analysis / slides for meeting with Ting tomorrow
  • new round of yellow chromatin RNA DNA double stains. Include attempt restain E10rna. Still needs RNase.
  • 3D z-calibration [POSTPONED]
  • Start statistical analysis of Blue Polymer simulations [POSTPONED]
  • Work on figures for Ph project [POSTPONED]

Chromatin Colors

Cell Staining

  • stained new RNA: D12 E08, E10
  • RNase treated E10rna sample.
  • new DNA stain for E10rna cells, attempt sequential imaging tomorrow.

STORM Imaging

  • Finish O/N STORM run of F08 on STORM2
  • Transfer data from STORM2 to Monet

Polymer Simulations

  • All simulations on Odyssey O/N ended in NODE-FAIL

Data Analysis

F11 (ANTC left, 180 kb) Observations

  • Highly variable

G10

  • Generally very large. Could use more spots.

F09 Observations:

  • F09 dots are way too big.
  • possible cross contamination?

F09dot_3

F09dot_1

F09bad_crosstalk

follow up on cross-talk in F09

  • Check cross contamination using M matrix. Looks pretty substantial (see above)
  • But previous analysis suggests most of these contaminates are not (nearly) full length.
  • Working on new pipeline to look at purity.
  • Looking at off target sequences that have 25 bp of sequence.
  • G02 and F09 have 3′ primer overlap! Need to screen this out! how was this missed by BLAST?
    ‘F09’ [ 216] ‘TCCGCCGTGTTATCGATTTG’
    ‘G02’ [1046] ‘ATTCAACGGCCCTCGATTTG’

Some dots look much more G2 like. Others maybe more
contamination_in_F09

G2_in_F09_Q

Basic Data Processing

  • Ran chromatic analysis for 13-11-24_D10 beads. Substantial offset (25+ pixels!) needed to register colors
  • Reran / troubleshot chromatic analysis for 13-11-01_F07 Beads
  • Ran chromatic analysis for 13-11-25_D08 beads.

Coding

  • Could use more robust matchmols function. When multiple molecules are within the match radius, chose the nearest.

Computer Stuff

  • Install updates and Reboot Tuck / Cajal
  • Install new 16Gb RAM (on Tuck?)
  • Tuck fails to boot with new ram. Despite the fact all modules are PC3-10600 4Gb DDR3 1333 MHz.
  • Ram is incompatible — needs to be ECC Registered ram.
  • Forgot to put fan cover back on Tuck before reboot. Will need to do this.
  • Install Matlab 2013b on Tuck, Cajal and Monet (requires all active versions of Matlab to be shut down).
  • downloaded 2013b directly from FAS website (download from mathworks site not enabled any more under current license).
  • OligoArrayAux / OligoArray2.1 now running on Tuck

Odyssey computing

  • all queue_Blue tasks ended with NODE_FAIL errors.
  • wrote to RC about repeated issues.
This entry was posted in Summaries and tagged , , . Bookmark the permalink.