Categories
- AP patterning (13)
- Blog (1)
- Chromatin (88)
- Conference Notes (72)
- Fly Work (54)
- General STORM (25)
- Genomics (134)
- Journal Club (22)
- Lab Meeting (66)
- Microscopy (79)
- Notes (1)
- probe and plasmid building (58)
- Project Meeting (3)
- Protocols (13)
- Research Planning (74)
- Seminars (21)
- Shadow Enhancers (59)
- snail patterning (40)
- Software Development (5)
- Summaries (1,412)
- Teaching (9)
- Transcription Modeling (40)
- Uncategorized (10)
- Web development (19)
Links
Tags
analysis cell culture cell labeling chromatin cloning coding communication confocal data analysis embryo collection embryo labeling figures fly work genomics hb image analysis image processing images in situs Library2 literature making antibodies matlab-storm meetings modeling MP12 mRNA counting Ph planning presentation probe making project 2 project2 result results sectioning section staining shadow enhancers sna snail staining STORM STORM analysis troubleshooting writing-
GitHub Projects
Monthly Archives: October 2015
Protected: new project planning
There is no excerpt because this is a protected post.
Posted in Research Planning
Comments Off on Protected: new project planning
Friday 10/16/15
9:00 am – 5:30 pm morning meetings Prep for meetings — printing docs and tuning slides 10:00 – 10:30, discussion with Harvard career advisor 11:00 – 12:30 discussion with BK and AW 12:30 – 2:00 pm: revisions to CV as … Continue reading
Posted in Summaries
Comments Off on Friday 10/16/15
Thursday 10/15/15
9:15 am Tasks flip fly stocks (Mp02 almost dead. added new food for viable larvae). Application uploads uploaded applications for MIT, Broad, and Stanford ChEM-H finished application for Harvard Med, but plan to upload after career advising appointment tomorrow morning … Continue reading
Posted in Summaries
Comments Off on Thursday 10/15/15
Wednesday 10/14/15
9:30 am – 9:00 pm ms review making notes on manuscript applications rewriting intro / motivation paragraph. new probes chr lib4 (MERFISH lib 5) C01 primer_145 CCATCAGCCGCGACCCTATG chr3R:12691420-12706420__BXC C02 primer_148 CTTTCTCGCAGGCGACTCGC chr3R:12706421-12721421__BXC C03 primer_150 ACGTTAGGTGCCTCGCTGCG chr3R:12721422-12736422__BXC C04 primer_152 CCCTCGGCGCAAAGTCTGTC chr3R:12736423-12751423__BXC … Continue reading
Posted in Summaries
Comments Off on Wednesday 10/14/15
Tuesday 10/13/15
9:00 am – 6:00 pm, 7:00 pm – 9:00 pm Goals finish response to reviewers, text edits, and figure edits for Ph-polymerization ms. Ph-polymerization working on response to reviewers (9:00 am – 11:00 am) Kc-cell seq prep change media over … Continue reading
Posted in Summaries
Comments Off on Tuesday 10/13/15
Monday 10/12/15
4:00 pm – 8:00 pm Ph-polymerization working on response to reviewers, round 2 analyzing cluster density of negative controls see new quantification in project Data folder Kc cell seq prep passage newly plated cells (10/05) into larger flasks (in SFX) … Continue reading
Posted in Summaries
Comments Off on Monday 10/12/15
Protected: EMBO 2015 Nucleus Meeting: day 5
There is no excerpt because this is a protected post.
Posted in Conference Notes
Comments Off on Protected: EMBO 2015 Nucleus Meeting: day 5
Protected: EMBO 2015 Nucleus Meeting: day 4
There is no excerpt because this is a protected post.
Posted in Conference Notes
Comments Off on Protected: EMBO 2015 Nucleus Meeting: day 4
Protected: EMBO 2015 Nucleus Meeting: day 3
There is no excerpt because this is a protected post.
Posted in Conference Notes
Comments Off on Protected: EMBO 2015 Nucleus Meeting: day 3
Protected: EMBO Nucleus Meeting: day 2
There is no excerpt because this is a protected post.
Posted in Conference Notes
Comments Off on Protected: EMBO Nucleus Meeting: day 2