November 2025 M T W T F S S « Aug 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 Categories
- AP patterning (13)
- Blog (1)
- Chromatin (88)
- Conference Notes (72)
- Fly Work (54)
- General STORM (25)
- Genomics (134)
- Journal Club (22)
- Lab Meeting (66)
- Microscopy (79)
- Notes (1)
- probe and plasmid building (58)
- Project Meeting (3)
- Protocols (13)
- Research Planning (74)
- Seminars (21)
- Shadow Enhancers (59)
- snail patterning (40)
- Software Development (5)
- Summaries (1,412)
- Teaching (9)
- Transcription Modeling (40)
- Uncategorized (10)
- Web development (19)
Links
Tags
analysis cell culture cell labeling chromatin cloning coding communication confocal data analysis embryo collection embryo labeling figures fly work genomics hb image analysis image processing images in situs Library2 literature making antibodies matlab-storm meetings modeling MP12 mRNA counting Ph planning presentation probe making project 2 project2 result results sectioning section staining shadow enhancers sna snail staining STORM STORM analysis troubleshooting writing-
GitHub Projects
Tag Archives: Ph
Monday 02/03/2014
10:00a – 11:50a Seminars Hao practice talk for lab meeting, 11a – 1p. Tamara’s seminar at the stat depart colloquium, (see notes) Ph Project manuscript work working on re-arranging figure panels and colors added whole cell images to figure 2 … Continue reading
Sunday 02/02/14
10:00a – 7:30p, 9:50p – 1:40a Literature need an article for journal club in 2 weeks. Elife article on transcription imaging from Tijan lab. Feng Zhang lab optical control of transcription. Optical control of transcription. Nature, this was published 7 … Continue reading
Friday 01/31/14
10:50a – 11:50p Goals Today Order primers for sequencing work on Ph manuscript finish hybes to test sample age image F03F04 samples Deep sequencing 2 probes to order with sequencing indices D12 (375kb) GTGTCGCGTCGGCCAGAAAC F11 (180kb) AGGACATTCGCGGCTTTCAG G09 (76kb) CGTCGCGTTGGATTCAAGAG … Continue reading
Thursday 01/30/14
9:55a – 10:00p Chromatin Project cell fixing and staining fix new Kc cells prep for in situ treat with RNase stain new kc cells with F03F04 and G01G02 Ph Data analysis wt data has half the number of frames (54,000 … Continue reading
Wednesday 01/29/14
9:10a – 8:00p, 9:50p – 2:30a Ph project revising manuscript draft working on abstract refocusing discussion of PcG clusters. Need to distinguish between the sparse micron-scale PcG bodies other people have studied and the numerous, nano-scale bodies we focus on. … Continue reading
Saturday 01/18/2014
10:30a – 7:20p, matlab-storm STORMrender online Getting Jeff set up with STORMrender debugging: STORMfinder added paths in initialization, allowing matlab-storm to access depreciated versions of code in folders that weren’t supposed to be on filepath Features to add to STORMrender … Continue reading
Posted in Summaries
Tagged chromatin, Library2, matlab-storm, Ph
Comments Off on Saturday 01/18/2014
Tuesday 01/14/14
9:45a – 12:15a Goals Today Rewrite ColorIntervalJumpGap.m Function to allow different gaps for different chromatin types. Select new Red regions Chromatin Project analysis Designing some new regions: notes Writing up summary of chromatin regions thus far: see protected notes. Let’s … Continue reading
Thursday 01/09/14
9:50a – 5:30p, 10:00p – 12:15a Goals file reimbursement paperwork for post-doc visit check to Colenso for ski trip help Sebastian design probes chromatin project Run probe design for new chromatin regions selected to test off-diagonal HiC contacts Too many … Continue reading
Protected: Ph project, cell variation issues
There is no excerpt because this is a protected post.
Wednesday 01/08/14
10:00a – 5:30p, 9:30p – 11:30p Ph project Ph project model figures for Ajaz. See post Reorganized figure producing code (see Code\Results) Chromatin analysis copying F05 data over to Probox 7 Running analysis of F03 and F04 while copying data … Continue reading