Author Archives: admin

9:00 am pairing meeting rehearse talk (8:45-9:15) see notes Experiments: QPCR for RNAi (9:15 am – 11:05 am) RNA concentrations from yesterday: 600 – 1200 ng/uL (55 uL volume) ran RNase H digestion last night, at 4C in block O/N. … Continue reading →

9:15 am – 6:30 pm presentations revising presentation for Pairing meeting with suggestions from BB (9:30 am – 12:30 pm) practice presentation Experiments 1 well of Ph KD and WT took through the RNAi treatment / wash / serum starve … Continue reading →

8:30 am – 7:00 pm background reading background research on subtelomeres for new XZ (8:30 a – 10:00 a) see notes and email. presentation prep working on polycomb bridging presentation for pairing meeting (2:30 – 7:00 pm) Imaging (10:00 am-1:00 … Continue reading →

10:15 am – 7:30 pm Goals Finish RNA hybes and check hb RNA stains Finish embryo BX-C 15 kb region hybes and check stains Finish draft of ppt presentation for pairing meeting. Probe synthesis Mix: 20 uL RNA 8 uL … Continue reading →

10:00 am – 6:50 pm Tasks send info to Stanford Dev Bio. finish and submit application to Cornell Physics (due today) write to XZ about new experimental design. synthesize lots more dsRNA start new KD of Ph experiment with 2 … Continue reading →

9:00 am – 5:30 pm morning meetings Prep for meetings — printing docs and tuning slides 10:00 – 10:30, discussion with Harvard career advisor 11:00 – 12:30 discussion with BK and AW 12:30 – 2:00 pm: revisions to CV as … Continue reading →

9:15 am Tasks flip fly stocks (Mp02 almost dead. added new food for viable larvae). Application uploads uploaded applications for MIT, Broad, and Stanford ChEM-H finished application for Harvard Med, but plan to upload after career advising appointment tomorrow morning … Continue reading →

9:30 am – 9:00 pm ms review making notes on manuscript applications rewriting intro / motivation paragraph. new probes chr lib4 (MERFISH lib 5) C01 primer_145 CCATCAGCCGCGACCCTATG chr3R:12691420-12706420__BXC C02 primer_148 CTTTCTCGCAGGCGACTCGC chr3R:12706421-12721421__BXC C03 primer_150 ACGTTAGGTGCCTCGCTGCG chr3R:12721422-12736422__BXC C04 primer_152 CCCTCGGCGCAAAGTCTGTC chr3R:12736423-12751423__BXC … Continue reading →

9:00 am – 6:00 pm, 7:00 pm – 9:00 pm Goals finish response to reviewers, text edits, and figure edits for Ph-polymerization ms. Ph-polymerization working on response to reviewers (9:00 am – 11:00 am) Kc-cell seq prep change media over … Continue reading →