Alistair's Lab Notebook

9:00 am

pairing meeting

• rehearse talk (8:45-9:15)
• see notes

Experiments: QPCR for RNAi (9:15 am – 11:05 am)

• RNA concentrations from yesterday: 600 – 1200 ng/uL (55 uL volume)
• ran RNase H digestion last night, at 4C in block O/N.
• ran clean up column (DCC5)
• cDNA concentrations from polyT primed RT reaction: 40 – 100 ng/uL

Setting up QPCR

• 40x master mix (9 primer pairs, 4 samples)
• per each (total for master)
  • 12.5 uL Hot-start Phusion mix (500 uL)
  • 2.5 uL Eva Green (50 uL)
  • 6 uL ddH2O (240 uL)
  • 2 uL cDNA
  • 2 uL primer
• plate layout
  • col 1:11 = Act, Tbu, Gapdh, ubx, Abd-B, Dfd, Antp, en, ph-p, ph-d1, ph-d2,
  • rows 1:4 = PhWT 1 10-16, PhWT 2 10-16, Wt 2 day 10-22, Ph 2 day 10-22.

9:15 am – 6:30 pm

presentations

• revising presentation for Pairing meeting with suggestions from BB (9:30 am – 12:30 pm)
• practice presentation

Experiments

• 1 well of Ph KD and WT took through the RNAi treatment / wash / serum starve with RNA procedure
• 1 well of Ph KD and WT took through RNA isolation
• also isolated RNA from samples which were treated last week.
• samples labeled Ph-WT 1, Ph-WT 2, (not certain on labels here, but QPCR will make clear), Ph-WT 2-day, Ph-Mock 2 day.
• will prep the 4-day samples on Saturday.
• setting up RT reactions to convert to cDNA.
• need to RNase H treat (running low on RNase H). Need to set up QPCR analysis

Literature

• Corces proposes loop extrusion model in review on Guo et al CTCF inversion by CRISPR paper
• also in this issue of Cell, Misteli Hipmap.
• reading Guo et al paper – quite excellent. downloaded supp mat as well, need more time to go through this long paper carefully.

8:30 am – 7:00 pm

background reading

• background research on subtelomeres for new XZ (8:30 a – 10:00 a)
• see notes and email.

presentation prep

• working on polycomb bridging presentation for pairing meeting (2:30 – 7:00 pm)

Imaging (10:00 am-1:00 pm)

• imaging hb-RNA labeled with DNA probes
  • very high background
  • use old RNA probes as control (should probably make fresh RNA)
  • try Xu/Golding protocol (much better detailed than Little/Gregor protocol)
• imaging 15 kb domains of BX-C in embryos of unpaired loci
  • post brief acid treatment + 90C denature.
  • nice bright staining
    

discussions

• MERFISH lunch (1:00 pm – 2:30pm)

10:15 am – 7:30 pm

Goals

• Finish RNA hybes and check hb RNA stains
• Finish embryo BX-C 15 kb region hybes and check stains
• Finish draft of ppt presentation for pairing meeting.

Probe synthesis

• Mix:
  • 20 uL RNA
  • 8 uL 5x buffer
  • 4 uL primer (P2 – P6)
  • 3 uL dNTPs
  • 2 uL Maxima
  • 3 uL RNasin
  • total 40 uL
• Master Mix 9x
  • 72 uL buffer
  • 27 uL dNTPs
  • 18 uL Maxima
  • 27 uL RNasin
• incubate 1 hr at 50C
• digest RNA with 50% 8mM NaOH + 50% .5M EDTA pH 8.0
• P order: C01 to C08 are P2, P4, P5, P6, P2, P4, P5, P6
• unfortunately the large bands appear to be stable concatimers in the ssDNA gel:
  • I bet they still work as probes, but it would be better if they came out the designed length.
  • I’m not sure what this does to my probe diversity

Embryo staining

• imaging samples on STORM5
• made new settings files in data/Alistair/settings on STORM5
• bright stains on E20-E24
• looks like decent staining on E24 alone. Will be easier to tell with mosaic tiling,
• hb-RNA looks reasonable, sections are a bit thick for easy smFISH, single fluors overlap.
  • also don’t have any nice cross-sections of early embryos, which would be best for analysis.
  • still looks promising. next time try at lower concentration.

RNAi

• finish dsRNA synthesis
  • digest DNA with DNase I + 30 uL ddH2O dilution (15 min at 37C)
  • purify RNA with RNA XP beads, eluted in 200 uL. Ph-p at ~1000 ng/uL and Ph-d at ~1500 ng/uL (this difference in production efficiency is quite reliable…)
  • 30 uL Ph-p and 40 Ph-d
  • 50 min treatment, then added serum

10:00 am – 6:50 pm

Tasks

• send info to Stanford Dev Bio.
• finish and submit application to Cornell Physics (due today)
• write to XZ about new experimental design.
• synthesize lots more dsRNA
• start new KD of Ph
  • experiment with 2 day KD, 3 day KD, daily serial KD,
• update website

Experiments

• dsRNA production
  • ran DCC5 column clean up on PCR products of ph-p and ph-d from last week
  • eluted in 20 uL and set up parallel 20 uL T7 reactions with 10 uL product each.
• cell culture
  • passaged cells, adherent cells from Schneider’s media culture moved back to SFX — my previous flask of cells in SFX is at too low density.
  • cells are ready for more RNAi as soon as I have dsRNA.
• probe production
  • ran new round of lib4 prep using 1:10 dilution of stock library. Samples C01 to C08 (with reverse primers G01 to G08)
  • this amplified sooner (nearing saturation at cycle 24 instead of waiting till after 30).
  • still have substantial amounts of large band product in all lanes except well 8. Well 8 was the last one to amplify.
  • still see rather high starting values broadly distributed (including 1 unpopulated well). suspect issue with QPCR camera. Should populate a different position on the plate next time.
• also note my old ladder is completely degraded. current ladder on bench degrading a bit.
  
• embryo labeling
  • treated embryo samples 5 min with .1 M HCl (previously skipped in failed labeling last week. BB thinks this step is important for labeling).
  • labeled E24 and E20-E24 on embryo sections (previously failed labeling last week).
  • incubated 3 min at 90C,
• try staining sectioned embryos with Hb smFISH probes
  • using fresh frozen embryo section.
  • 1 uL probe in 30 uL hybe dilution buffer, incubating at 37C overnight.

new project planning

• see protected post.

Reading

• Sluis et al 2015 G&D: CRISPR/Cas9 induction of DSBs
• Aymard et al NSMB 2014
• Clynes et al PLoS ONE 2014 (nice immunoFISH)
• Roukos et al, Science 2013
• Iacovoni et al EMBO 2010

9:00 am – 5:30 pm

morning meetings

• Prep for meetings — printing docs and tuning slides
• 10:00 – 10:30, discussion with Harvard career advisor
• 11:00 – 12:30 discussion with BK and AW
• 12:30 – 2:00 pm: revisions to CV as discussed. Upload app to Harv. Med Cell Bio.

afternoon tasks

• finish writing review
• revisions and edits to figures for Ph polymerization ms
• library design for new project, see protected post.

9:15 am

Tasks

• flip fly stocks (Mp02 almost dead. added new food for viable larvae).

Application uploads

• uploaded applications for MIT, Broad, and Stanford ChEM-H
• finished application for Harvard Med, but plan to upload after career advising appointment tomorrow morning (application due 10/16).

9:30 am – 9:00 pm

ms review

• making notes on manuscript

applications

• rewriting intro / motivation paragraph.

new probes

• chr lib4 (MERFISH lib 5)
  
C01 primer_145 CCATCAGCCGCGACCCTATG chr3R:12691420-12706420__BXC
C02 primer_148 CTTTCTCGCAGGCGACTCGC chr3R:12706421-12721421__BXC
C03 primer_150 ACGTTAGGTGCCTCGCTGCG chr3R:12721422-12736422__BXC
C04 primer_152 CCCTCGGCGCAAAGTCTGTC chr3R:12736423-12751423__BXC
C05 primer_155 AATGCGGCGGAGTGACTTGC chr3R:12751424-12766424__BXC
C06 primer_157 CGATTTCGCGCCGCACTTTC chr3R:12766425-12781425__BXC
C07 primer_160 TTTGCTTGTGCGCCGGAAAG chr3R:12781426-12796426__BXC
C08 primer_162 GCTTCGCGTCTGCCGGAAGG chr3R:12796427-12810708__BXC
G01 primer_147 TAATACGACTCACTATAGGGCGACGGCTTTAGGGCCTCCG chr3R:12691420-12706420__BXC
G02 primer_149 TAATACGACTCACTATAGGGAAACGCGGGTGAACGCTCTG chr3R:12706421-12721421__BXC
G03 primer_151 TAATACGACTCACTATAGGGCCATATTCCGCGCATCTGGC chr3R:12721422-12736422__BXC
G04 primer_153 TAATACGACTCACTATAGGGCCGGACGAATCAGCCTTCC chr3R:12736423-12751423__BXC
G05 primer_156 TAATACGACTCACTATAGGGCGGACGGTCGGATTCTTGG chr3R:12751424-12766424__BXC
G06 primer_158 TAATACGACTCACTATAGGGCCGTCATCGCCGGAACTTTG chr3R:12766425-12781425__BXC
G07 primer_161 TAATACGACTCACTATAGGGCCCGTCTAGGCGCATGAACG chr3R:12781426-12796426__BXC
G08 primer_163 TAATACGACTCACTATAGGGTCAGATCGGCGCTCCGAATC chr3R:12796427-12810708__BXC


funny issues with amplification

• bubbles or something make very high starting levels of signal in QPCR in some chambers (5000 RU, baseline 2000 RU). This is as bright as the typical max
• as bubbles pop this drops down and then goes up again
• amplification is quite late.
• I think there are issues with this lib, test by gel
  
• try again after I submit my applications
• spec the primers (unfortunate — these were supposed to be diluted to fixed conc by IDT, maybe the need a good spin down?)
• go back to TSTORM-L5 source library — I think this dilution is no good.
• drop max on QPCR down to 28 cycles.

Cell culture and Knockdown

• moved samples to 28C for ~6 hours — RT is getting a bit cold maybe to keep up with KD, 28 is recommended culture condition.

New stains

• selected 3 coverslips
• incubated in 5% formaldhyde to dissolve sucrose and fix
• 10 min in .5% Triton
• rinse in PBS
• 2x SCC wash 10 min
• 50% formamide 2X SSC wash 10 min at 37 C
• add probe (1 uL probe + .7 uL S2-A647) denature at 78C upstairs (block is being unstable again :()
• heat block dropped from 78 to 73 (by both digital and analog thermometers) during 3 min denaturation of samples E22 and E23
• letting warm up again, denaturing sample E24

Some numbers on restriction enzymes

• AsiSI, an 8 cutter, 1 per megabase, 1000 target sites in the genome (probably too many)
• I-SceI, an 18 cutter (used by Mistelli) not in human genome.
• PI-PkoII 2CW7 Pyrococcus kodakaraensis KOD1 A 5′ CAGTACTACGGTTAC / 3′ GTCATGATGCCAATG

9:00 am – 6:00 pm, 7:00 pm – 9:00 pm

Goals

• finish response to reviewers, text edits, and figure edits for Ph-polymerization ms.

Ph-polymerization

• working on response to reviewers (9:00 am – 11:00 am)

Kc-cell seq prep

• change media over to Schneider’s in serum
• room is a bit cold (23 C), setting incubator to 28 C
• prep cells with new Ph – KD
• only enough dsRNA to do 1 well (sad)
• can’t find primers to make more dsRNA for Ph-p and Ph-d
  • I left these out on my bench to make more, before my bench got taken over for pipette calibrations and then again for random stuff when I was gone. Probably will need to order more.

Applications

• started Stanford ChEM-H app
• registered on academic jobs online

Reading

• Raj perspective piece on circuit systems bio vs. omics bio.
• Bartman and Blobel on perturbing chromatin structure

Other

• sent Jeff and Steven copy of chromatin ms.
• reply to request for reagents: will send after ms is published
• lab open house: 7pm – 9pm